# HG changeset patch
# User alperkucukural
# Date 1446669022 18000
# Node ID 10db17004ffa079e65590ba8afe26f7b3ef01e20
# Parent 891408eaa9f0ad8a65e9948d8243410b0af54249
planemo upload
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/.shed.yml
--- a/CRISPRSeek/.shed.yml Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-categories: [Sequence Analysis]
-description: CRISPRseek Bioconductor package
-homepage_url: http://www.bioconductor.org/packages/release/bioc/html/CRISPRseek.html
-long_description: The package includes functions to find potential guide RNAs for input target sequences, optionally filter guide RNAs without restriction enzyme cut site, or without paired guide RNAs, genome-wide search for off-targets, score, rank, fetch flank sequence and indicate whether the target and off-targets are located in exon region or not.
-name: crisprseek
-owner: nephantes
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/compare2sequences.xml
--- a/CRISPRSeek/compare2sequences.xml Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,147 +0,0 @@
-
- CRISPRSeek compare2sequences
-
- crisprseek_macros.xml
-
-
-
- Rscript "${compare2sequences}"
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-**What it does**
-
-The package includes functions to find potential guide RNAs for input target se-
-quences, optionally filter guide RNAs without restriction enzyme cut site, or with-
-out paired guide RNAs, genome-wide search for off-targets, score, rank, fetch flank se-
-quence and indicate whether the target and off-targets are located in exon region or not. Poten-
-tial guide RNAs are annotated with total score of the top5 and topN off-targets, de-
-tailed topN mismatch sites, restriction enzyme cut sites, and paired guide RNAs.
-
-**Description**
-
-Generate all possible guide RNAs (gRNAs) for two input sequences, or two sets of sequences and generate scores for potential off-targets in the other sequence.
-
-**Usage**
-
- compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"), format = "fasta", findgRNAsWithREcutOnly = FALSE, searchDirection=c("both","1to2", "2to1"), REpatternFile=system.file("extdata", "NEBenzymes.fa", package = "CRISPRseek"), minREpatternSize = 6, overlap.gRNA.positions = c(17, 18), findPairedgRNAOnly = FALSE, min.gap = 0, max.gap = 20, gRNA.name.prefix = "gRNA", PAM.size = 3, gRNA.size = 20, PAM = "NGG", PAM.pattern = "N[A|G]G$", max.mismatch = 3, outputDir, weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583), overwrite = FALSE)
-
-**Author(s)**
-
-Lihua Julie Zhu and Michael Brodsky Maintainer: julie.zhu@umassmed.edu
-
-Alper Kucukural, Galaxy Maintainer: alper.kucukural@umassmed.edu
-
-**Citation**
-
-(from within R, enter citation("CRISPRseek")):
-
-Zhu LJ, Holmes BR, Aronin N and Brodsky MH (2014). “CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide RNAs for CRISPR-Cas9 Genome-Editing Systems.” PLoS one, 9(9). http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4172692/.
-
-**References**
-
-Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agar-
-wala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini,
-Gang Bao, Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
-Biotechnology 31:827-83
-
-Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM.CAS9
-transcriptional activators for target specificity screening and paired nickases for cooperative genome
-engineering. Nat Biotechnol. 2013. 31(9):833-8 Patrick D Hsu, David A Scott, Joshua A Wein-
-stein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
-Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao, Feng Zhang. DNA targeting
-specificity of rNA-guided Cas9 nucleases. Nat Biotechnol. 2013. 31:827-834
-
-**Reference Manual and Materials**
-
-http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.pdf
-
-http://www.bioconductor.org/packages/release/bioc/manuals/CRISPRseek/man/CRISPRseek.pdf
-
-http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.R
-
-
-
-
-
-
-
-
-
-
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/crisprseek_macros.xml
--- a/CRISPRSeek/crisprseek_macros.xml Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
-
-
-
- R
- CRISPRseek
-
-
-
-
- 10.1371/journal.pone.0108424
-
-
-
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/offtargetanalysis.xml
--- a/CRISPRSeek/offtargetanalysis.xml Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,162 +0,0 @@
-
- CRISPRSeek offTargetAnalysis
-
- crisprseek_macros.xml
-
-
-
- Rscript "${offTargetAnalysis}"
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-**What it does**
-
-The package includes functions to find potential guide RNAs for input target se-
-quences, optionally filter guide RNAs without restriction enzyme cut site, or with-
-out paired guide RNAs, genome-wide search for off-targets, score, rank, fetch flank se-
-quence and indicate whether the target and off-targets are located in exon region or not. Poten-
-tial guide RNAs are annotated with total score of the top5 and topN off-targets, de-
-tailed topN mismatch sites, restriction enzyme cut sites, and paired guide RNAs.
-
-**Description**
-
-Design of target-specific gRNAs for the CRISPR-Cas9 system by automatically finding potential
-gRNAs (paired/not paired), with/without restriction enzyme cut site(s) in a given sequence, search-
-ing for off targets with user defined maximum number of mismatches, calculating score of each
-off target based on mismatch positions in the off target and a penalty weight matrix, filtering off
-targets with user-defined criteria, and annotating off targets with flank sequences, whether located
-in exon or not. Summary report is also generated with gRNAs ranked by total topN off target
-score, annotated with restriction enzyme cut sites and possible paired gRNAs. Detailed paired gR-
-NAs information and restriction enzyme cut sites are stored in separate files in the output directory
-specified by the user. In total, four tab delimited files are generated in the output directory: Off-
-targetAnalysis.xls (off target details), Summary.xls (gRNA summary), REcutDetails.xls (restriction
-enzyme cut sites of each gRNA), and pairedgRNAs.xls (potential paired gRNAs).
-
-**Author(s)**
-
-Lihua Julie Zhu and Michael Brodsky Maintainer: julie.zhu@umassmed.edu
-
-**Citation**
-
-(from within R, enter citation("CRISPRseek")):
-
-Zhu LJ, Holmes BR, Aronin N and Brodsky MH (2014). “CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide RNAs for CRISPR-Cas9 Genome-Editing Systems.” PLoS one, 9(9). http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4172692/.
-
-**References**
-
-http://bioconductor.org/packages/2.8/bioc/vignettes/BSgenome/inst/doc/GenomeSearching.pdf
-
-Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agar-
-wala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini,
-Gang Bao, Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
-Biotechnology 31:827-83
-
-Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM.CAS9
-transcriptional activators for target specificity screening and paired nickases for cooperative genome
-engineering. Nat Biotechnol. 2013. 31(9):833-8 Patrick D Hsu, David A Scott, Joshua A Wein-
-stein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
-Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao, Feng Zhang. DNA targeting
-specificity of rNA-guided Cas9 nucleases. Nat Biotechnol. 2013. 31:827-834
-
-**Reference Manual and Materials**
-
-http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.pdf
-
-http://www.bioconductor.org/packages/release/bioc/manuals/CRISPRseek/man/CRISPRseek.pdf
-
-http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.R
-
-
-
-
-
-
-
-
-
-
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/test_data/inputfile.fa
--- a/CRISPRSeek/test_data/inputfile.fa Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,54 +0,0 @@
->mRIPK1cds1_gR36f
-AATGCAACCAGACATGTCCTTGG
->mRIPK1cds1_gR51f
-GTCCTTGGACAATATTAAGATGG
->mRIPK1cds1_gR69f
-GATGGCATCCAGTGACCTGCTGG
->mRIPK1cds1_gR91f
-GAGAAGACAGACCTAGACAGCGG
->mRIPK1cds1_gR94f
-AAGACAGACCTAGACAGCGGAGG
->mRIPK1cds1_gR100f
-GACCTAGACAGCGGAGGCTTCGG
->mRIPK1cds1_gR101f
-ACCTAGACAGCGGAGGCTTCGGG
->mRIPK1cds1_gR105f
-AGACAGCGGAGGCTTCGGGAAGG
->mRIPK1cds1_gR133f
-TTGTGTTACCACAGAAGCCATGG
->mRIPK1cds1_gR163f
-ATCCTGAAAAAAGTATACACAGG
->mRIPK1cds1_gR164f
-TCCTGAAAAAAGTATACACAGGG
->mRIPK1cds1_gR187f
-CCCAACCGCGCTGAGTGAGTTGG
->mRIPK1cds1_gR188f
-CCAACCGCGCTGAGTGAGTTGGG
->mRIPK1cds1_gR189f
-CAACCGCGCTGAGTGAGTTGGGG
->mRIPK1cds1_gR190f
-AACCGCGCTGAGTGAGTTGGGGG
->mRIPK1cds1_gR182r
-TGCCCCCAACTCACTCAGCGCGG
->mRIPK1cds1_gR178r
-CCCAACTCACTCAGCGCGGTTGG
->mRIPK1cds1_gR177r
-CCAACTCACTCAGCGCGGTTGGG
->mRIPK1cds1_gR155r
-GCCCTGTGTATACTTTTTTCAGG
->mRIPK1cds1_gR140r
-TTTTCAGGATGACAAATCCATGG
->mRIPK1cds1_gR131r
-TGACAAATCCATGGCTTCTGTGG
->mRIPK1cds1_gR121r
-ATGGCTTCTGTGGTAACACAAGG
->mRIPK1cds1_gR92r
-TCCCGAAGCCTCCGCTGTCTAGG
->mRIPK1cds1_gR74r
-CTAGGTCTGTCTTCTCCAGCAGG
->mRIPK1cds1_gR67r
-TGTCTTCTCCAGCAGGTCACTGG
->mRIPK1cds1_gR43r
-TGCCATCTTAATATTGTCCAAGG
->mRIPK1cds1_gR33r
-ATATTGTCCAAGGACATGTCTGG
diff -r 891408eaa9f0 -r 10db17004ffa CRISPRSeek/tool_dependencies.xml
--- a/CRISPRSeek/tool_dependencies.xml Tue Nov 03 10:12:14 2015 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000
@@ -1,9 +0,0 @@
-
-
-
-
-
-
-
-
-
diff -r 891408eaa9f0 -r 10db17004ffa compare2sequences.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/compare2sequences.xml Wed Nov 04 15:30:22 2015 -0500
@@ -0,0 +1,147 @@
+
+ CRISPRSeek compare2sequences
+
+ crisprseek_macros.xml
+
+
+
+ Rscript "${compare2sequences}"
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+The package includes functions to find potential guide RNAs for input target se-
+quences, optionally filter guide RNAs without restriction enzyme cut site, or with-
+out paired guide RNAs, genome-wide search for off-targets, score, rank, fetch flank se-
+quence and indicate whether the target and off-targets are located in exon region or not. Poten-
+tial guide RNAs are annotated with total score of the top5 and topN off-targets, de-
+tailed topN mismatch sites, restriction enzyme cut sites, and paired guide RNAs.
+
+**Description**
+
+Generate all possible guide RNAs (gRNAs) for two input sequences, or two sets of sequences and generate scores for potential off-targets in the other sequence.
+
+**Usage**
+
+ compare2Sequences(inputFile1Path, inputFile2Path, inputNames=c("Seq1", "Seq2"), format = "fasta", findgRNAsWithREcutOnly = FALSE, searchDirection=c("both","1to2", "2to1"), REpatternFile=system.file("extdata", "NEBenzymes.fa", package = "CRISPRseek"), minREpatternSize = 6, overlap.gRNA.positions = c(17, 18), findPairedgRNAOnly = FALSE, min.gap = 0, max.gap = 20, gRNA.name.prefix = "gRNA", PAM.size = 3, gRNA.size = 20, PAM = "NGG", PAM.pattern = "N[A|G]G$", max.mismatch = 3, outputDir, weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583), overwrite = FALSE)
+
+**Author(s)**
+
+Lihua Julie Zhu and Michael Brodsky Maintainer: julie.zhu@umassmed.edu
+
+Alper Kucukural, Galaxy Maintainer: alper.kucukural@umassmed.edu
+
+**Citation**
+
+(from within R, enter citation("CRISPRseek")):
+
+Zhu LJ, Holmes BR, Aronin N and Brodsky MH (2014). “CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide RNAs for CRISPR-Cas9 Genome-Editing Systems.” PLoS one, 9(9). http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4172692/.
+
+**References**
+
+Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agar-
+wala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini,
+Gang Bao, Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
+Biotechnology 31:827-83
+
+Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM.CAS9
+transcriptional activators for target specificity screening and paired nickases for cooperative genome
+engineering. Nat Biotechnol. 2013. 31(9):833-8 Patrick D Hsu, David A Scott, Joshua A Wein-
+stein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
+Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao, Feng Zhang. DNA targeting
+specificity of rNA-guided Cas9 nucleases. Nat Biotechnol. 2013. 31:827-834
+
+**Reference Manual and Materials**
+
+http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.pdf
+
+http://www.bioconductor.org/packages/release/bioc/manuals/CRISPRseek/man/CRISPRseek.pdf
+
+http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.R
+
+
+
+
+
+
+
+
+
+
diff -r 891408eaa9f0 -r 10db17004ffa crisprseek_macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/crisprseek_macros.xml Wed Nov 04 15:30:22 2015 -0500
@@ -0,0 +1,13 @@
+
+
+
+ R
+ CRISPRseek
+
+
+
+
+ 10.1371/journal.pone.0108424
+
+
+
diff -r 891408eaa9f0 -r 10db17004ffa offtargetanalysis.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/offtargetanalysis.xml Wed Nov 04 15:30:22 2015 -0500
@@ -0,0 +1,162 @@
+
+ CRISPRSeek offTargetAnalysis
+
+ crisprseek_macros.xml
+
+
+
+ Rscript "${offTargetAnalysis}"
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+The package includes functions to find potential guide RNAs for input target se-
+quences, optionally filter guide RNAs without restriction enzyme cut site, or with-
+out paired guide RNAs, genome-wide search for off-targets, score, rank, fetch flank se-
+quence and indicate whether the target and off-targets are located in exon region or not. Poten-
+tial guide RNAs are annotated with total score of the top5 and topN off-targets, de-
+tailed topN mismatch sites, restriction enzyme cut sites, and paired guide RNAs.
+
+**Description**
+
+Design of target-specific gRNAs for the CRISPR-Cas9 system by automatically finding potential
+gRNAs (paired/not paired), with/without restriction enzyme cut site(s) in a given sequence, search-
+ing for off targets with user defined maximum number of mismatches, calculating score of each
+off target based on mismatch positions in the off target and a penalty weight matrix, filtering off
+targets with user-defined criteria, and annotating off targets with flank sequences, whether located
+in exon or not. Summary report is also generated with gRNAs ranked by total topN off target
+score, annotated with restriction enzyme cut sites and possible paired gRNAs. Detailed paired gR-
+NAs information and restriction enzyme cut sites are stored in separate files in the output directory
+specified by the user. In total, four tab delimited files are generated in the output directory: Off-
+targetAnalysis.xls (off target details), Summary.xls (gRNA summary), REcutDetails.xls (restriction
+enzyme cut sites of each gRNA), and pairedgRNAs.xls (potential paired gRNAs).
+
+**Author(s)**
+
+Lihua Julie Zhu and Michael Brodsky Maintainer: julie.zhu@umassmed.edu
+
+**Citation**
+
+(from within R, enter citation("CRISPRseek")):
+
+Zhu LJ, Holmes BR, Aronin N and Brodsky MH (2014). “CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide RNAs for CRISPR-Cas9 Genome-Editing Systems.” PLoS one, 9(9). http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4172692/.
+
+**References**
+
+http://bioconductor.org/packages/2.8/bioc/vignettes/BSgenome/inst/doc/GenomeSearching.pdf
+
+Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agar-
+wala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini,
+Gang Bao, Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature
+Biotechnology 31:827-83
+
+Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S, Yang L, Church GM.CAS9
+transcriptional activators for target specificity screening and paired nickases for cooperative genome
+engineering. Nat Biotechnol. 2013. 31(9):833-8 Patrick D Hsu, David A Scott, Joshua A Wein-
+stein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu,
+Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao, Feng Zhang. DNA targeting
+specificity of rNA-guided Cas9 nucleases. Nat Biotechnol. 2013. 31:827-834
+
+**Reference Manual and Materials**
+
+http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.pdf
+
+http://www.bioconductor.org/packages/release/bioc/manuals/CRISPRseek/man/CRISPRseek.pdf
+
+http://www.bioconductor.org/packages/release/bioc/vignettes/CRISPRseek/inst/doc/CRISPRseek.R
+
+
+
+
+
+
+
+
+
+
diff -r 891408eaa9f0 -r 10db17004ffa test_data/inputfile.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test_data/inputfile.fa Wed Nov 04 15:30:22 2015 -0500
@@ -0,0 +1,54 @@
+>mRIPK1cds1_gR36f
+AATGCAACCAGACATGTCCTTGG
+>mRIPK1cds1_gR51f
+GTCCTTGGACAATATTAAGATGG
+>mRIPK1cds1_gR69f
+GATGGCATCCAGTGACCTGCTGG
+>mRIPK1cds1_gR91f
+GAGAAGACAGACCTAGACAGCGG
+>mRIPK1cds1_gR94f
+AAGACAGACCTAGACAGCGGAGG
+>mRIPK1cds1_gR100f
+GACCTAGACAGCGGAGGCTTCGG
+>mRIPK1cds1_gR101f
+ACCTAGACAGCGGAGGCTTCGGG
+>mRIPK1cds1_gR105f
+AGACAGCGGAGGCTTCGGGAAGG
+>mRIPK1cds1_gR133f
+TTGTGTTACCACAGAAGCCATGG
+>mRIPK1cds1_gR163f
+ATCCTGAAAAAAGTATACACAGG
+>mRIPK1cds1_gR164f
+TCCTGAAAAAAGTATACACAGGG
+>mRIPK1cds1_gR187f
+CCCAACCGCGCTGAGTGAGTTGG
+>mRIPK1cds1_gR188f
+CCAACCGCGCTGAGTGAGTTGGG
+>mRIPK1cds1_gR189f
+CAACCGCGCTGAGTGAGTTGGGG
+>mRIPK1cds1_gR190f
+AACCGCGCTGAGTGAGTTGGGGG
+>mRIPK1cds1_gR182r
+TGCCCCCAACTCACTCAGCGCGG
+>mRIPK1cds1_gR178r
+CCCAACTCACTCAGCGCGGTTGG
+>mRIPK1cds1_gR177r
+CCAACTCACTCAGCGCGGTTGGG
+>mRIPK1cds1_gR155r
+GCCCTGTGTATACTTTTTTCAGG
+>mRIPK1cds1_gR140r
+TTTTCAGGATGACAAATCCATGG
+>mRIPK1cds1_gR131r
+TGACAAATCCATGGCTTCTGTGG
+>mRIPK1cds1_gR121r
+ATGGCTTCTGTGGTAACACAAGG
+>mRIPK1cds1_gR92r
+TCCCGAAGCCTCCGCTGTCTAGG
+>mRIPK1cds1_gR74r
+CTAGGTCTGTCTTCTCCAGCAGG
+>mRIPK1cds1_gR67r
+TGTCTTCTCCAGCAGGTCACTGG
+>mRIPK1cds1_gR43r
+TGCCATCTTAATATTGTCCAAGG
+>mRIPK1cds1_gR33r
+ATATTGTCCAAGGACATGTCTGG
diff -r 891408eaa9f0 -r 10db17004ffa tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Wed Nov 04 15:30:22 2015 -0500
@@ -0,0 +1,9 @@
+
+
+
+
+
+
+
+
+