|
0
|
1 <tool id="vcfprimers" name="VCFprimers:" version="0.0.1">
|
|
|
2 <requirements>
|
|
|
3 <requirement type="package" version="586c5ae5d57a38dae6b32ea831fb1f7cfa14c9bd">vcflib</requirement>
|
|
|
4 <!-- <requirement type="package" version="0.1.18">samtools</requirement> -->
|
|
|
5 </requirements>
|
|
|
6 <description>Extract flanking sequences for each VCF record</description>
|
|
|
7 <command>
|
|
|
8 #set $reference_fasta_filename = "localref.fa"
|
|
|
9 #if str( $reference_source.reference_source_selector ) == "history":
|
|
|
10 ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &&
|
|
|
11 #else:
|
|
|
12 #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
|
|
|
13 #end if
|
|
|
14 vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
|
|
|
15 <inputs>
|
|
|
16 <param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
|
|
|
17 <conditional name="reference_source">
|
|
|
18 <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
|
|
|
19 <option value="cached">Locally cached</option>
|
|
|
20 <option value="history">History</option>
|
|
|
21 </param>
|
|
|
22 <when value="cached">
|
|
|
23 <param name="ref_file" type="select" label="Select reference genome">
|
|
|
24 <options from_data_table="fasta_indexes">
|
|
|
25 </options>
|
|
|
26 <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
|
|
|
27 </param>
|
|
|
28 </when>
|
|
|
29 <when value="history"> <!-- FIX ME!!!! -->
|
|
|
30 <param name="ref_file" type="data" format="fasta" label="Using reference file" />
|
|
|
31 </when>
|
|
|
32 </conditional>
|
|
|
33 <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
|
|
|
34 </inputs>
|
|
|
35 <outputs>
|
|
|
36 <data format="fasta" name="out_file1" />
|
|
|
37 </outputs>
|
|
|
38 <stdio>
|
|
|
39 <exit_code range="1:" level="fatal" />
|
|
|
40 </stdio>
|
|
|
41 <tests>
|
|
|
42 <test>
|
|
|
43 <param name="reference_source_selector" value="history" />
|
|
|
44 <param name="input_vcf" value="vcflib-phix.vcf"/>
|
|
|
45 <param name="ref_file" value="vcflib-test-genome-phix.fa" />
|
|
|
46 <param name="primer_length" value="5" />
|
|
|
47 <output name="out_file1" file="vcfprimers-test1.fasta"/>
|
|
|
48 </test>
|
|
|
49 </tests>
|
|
|
50 <help>
|
|
|
51
|
|
|
52 For each VCF record, extract the flanking sequences, and write them to stdout as FASTA
|
|
|
53 records suitable for alignment. This tool is intended for use in designing validation
|
|
|
54 experiments. Primers extracted which would flank all of the alleles at multi-allelic
|
|
|
55 sites. The name of the FASTA "reads" indicates the VCF record which they apply to.
|
|
|
56 The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
|
|
|
57 for example::
|
|
|
58
|
|
|
59 >20_233255_LEFT
|
|
|
60 CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
|
|
|
61 >20_233255_RIGHT
|
|
|
62 ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA
|
|
|
63
|
|
|
64 ----
|
|
|
65
|
|
|
66 Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib).
|
|
|
67
|
|
|
68 </help>
|
|
|
69 </tool>
|
