Mercurial > repos > anton > vcfprimers
annotate vcfprimers.xml @ 3:f3243301d74f draft default tip
Uploaded
author | anton |
---|---|
date | Mon, 15 Sep 2014 14:53:14 -0400 |
parents | 47dd84123b42 |
children |
rev | line source |
---|---|
2
47dd84123b42
Updated tool version to 0.0.2
Anton Nekrutenko <anton@bx.psu.edu>
parents:
1
diff
changeset
|
1 <tool id="vcfprimers" name="VCFprimers:" version="0.0.2"> |
0 | 2 <requirements> |
3 | 3 <requirement type="package" version="8a5602bf07">vcflib</requirement> |
0 | 4 <!-- <requirement type="package" version="0.1.18">samtools</requirement> --> |
5 </requirements> | |
6 <description>Extract flanking sequences for each VCF record</description> | |
7 <command> | |
8 #set $reference_fasta_filename = "localref.fa" | |
9 #if str( $reference_source.reference_source_selector ) == "history": | |
10 ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && | |
11 #else: | |
12 #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) | |
13 #end if | |
14 vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command> | |
15 <inputs> | |
16 <param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" /> | |
17 <conditional name="reference_source"> | |
18 <param name="reference_source_selector" type="select" label="Choose the source for the reference genome"> | |
19 <option value="cached">Locally cached</option> | |
20 <option value="history">History</option> | |
21 </param> | |
22 <when value="cached"> | |
23 <param name="ref_file" type="select" label="Select reference genome"> | |
24 <options from_data_table="fasta_indexes"> | |
25 </options> | |
26 <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> | |
27 </param> | |
28 </when> | |
29 <when value="history"> <!-- FIX ME!!!! --> | |
30 <param name="ref_file" type="data" format="fasta" label="Using reference file" /> | |
31 </when> | |
32 </conditional> | |
33 <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" /> | |
34 </inputs> | |
35 <outputs> | |
36 <data format="fasta" name="out_file1" /> | |
37 </outputs> | |
38 <stdio> | |
39 <exit_code range="1:" level="fatal" /> | |
40 </stdio> | |
41 <tests> | |
42 <test> | |
43 <param name="reference_source_selector" value="history" /> | |
44 <param name="input_vcf" value="vcflib-phix.vcf"/> | |
45 <param name="ref_file" value="vcflib-test-genome-phix.fa" /> | |
46 <param name="primer_length" value="5" /> | |
47 <output name="out_file1" file="vcfprimers-test1.fasta"/> | |
48 </test> | |
49 </tests> | |
50 <help> | |
51 | |
3 | 52 For each VCF record, extract the flanking sequences, and write them as FASTA |
0 | 53 records suitable for alignment. This tool is intended for use in designing validation |
54 experiments. Primers extracted which would flank all of the alleles at multi-allelic | |
55 sites. The name of the FASTA "reads" indicates the VCF record which they apply to. | |
56 The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, | |
57 for example:: | |
58 | |
59 >20_233255_LEFT | |
60 CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA | |
61 >20_233255_RIGHT | |
62 ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA | |
63 | |
64 ---- | |
65 | |
66 Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib). | |
67 | |
68 </help> | |
69 </tool> |