Mercurial > repos > anton > vcfprimers

comparison vcfprimers.xml @ 0:cee219e163fa

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author anton
date Wed, 11 Jun 2014 17:10:20 -0400
parents
children 8be427d0e4c3
comparison
equal deleted inserted replaced
-1:000000000000 0:cee219e163fa
1 <tool id="vcfprimers" name="VCFprimers:" version="0.0.1">
2 <requirements>
3 <requirement type="package" version="586c5ae5d57a38dae6b32ea831fb1f7cfa14c9bd">vcflib</requirement>
4 <!-- <requirement type="package" version="0.1.18">samtools</requirement> -->
5 </requirements>
6 <description>Extract flanking sequences for each VCF record</description>
7 <command>
8 #set $reference_fasta_filename = "localref.fa"
9 #if str( $reference_source.reference_source_selector ) == "history":
10 ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &amp;&amp;
11 #else:
12 #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
13 #end if
14 vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
15 <inputs>
16 <param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
17 <conditional name="reference_source">
18 <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
19 <option value="cached">Locally cached</option>
20 <option value="history">History</option>
21 </param>
22 <when value="cached">
23 <param name="ref_file" type="select" label="Select reference genome">
24 <options from_data_table="fasta_indexes">
25 </options>
26 <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
27 </param>
28 </when>
29 <when value="history"> <!-- FIX ME!!!! -->
30 <param name="ref_file" type="data" format="fasta" label="Using reference file" />
31 </when>
32 </conditional>
33 <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
34 </inputs>
35 <outputs>
36 <data format="fasta" name="out_file1" />
37 </outputs>
38 <stdio>
39 <exit_code range="1:" level="fatal" />
40 </stdio>
41 <tests>
42 <test>
43 <param name="reference_source_selector" value="history" />
44 <param name="input_vcf" value="vcflib-phix.vcf"/>
45 <param name="ref_file" value="vcflib-test-genome-phix.fa" />
46 <param name="primer_length" value="5" />
47 <output name="out_file1" file="vcfprimers-test1.fasta"/>
48 </test>
49 </tests>
50 <help>
51
52 For each VCF record, extract the flanking sequences, and write them to stdout as FASTA
53 records suitable for alignment. This tool is intended for use in designing validation
54 experiments. Primers extracted which would flank all of the alleles at multi-allelic
55 sites. The name of the FASTA "reads" indicates the VCF record which they apply to.
56 The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
57 for example::
58
59 >20_233255_LEFT
60 CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
61 >20_233255_RIGHT
62 ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA
63
64 ----
65
66 Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib).
67
68 </help>
69 </tool>