<tool id="fetchflank" name="Fetch flanking bases" version="1.0.0">
  <description> of microsatellites and output as two fastq files in forward-forward orientation</description>
  <command interpreter="python">pair_fetch_DNA_ff.py  $microsat_in_read $Leftflanking $Rightflanking $qualitycutoff $lengthofbasetocheckquality  </command>

  <inputs>
    <param name="microsat_in_read" type="data" label="Select data of microsatellites in reads" />
    <param name="qualitycutoff" type="integer" value="20" label="Minimum quality score (Phred+33) for microsatellites and flanking regions" />
    <param name="lengthofbasetocheckquality" type="integer" value="20" label="Length of flanking regions that require quality screening" />        
  </inputs>
  <outputs>
    <data format="fastq" name="Leftflanking" />
    <data format="fastq" name="Rightflanking" />
  </outputs>
  <tests>
    <!-- Test data with valid values -->
    <test>
      <param name="microsat_in_read" value="samplefq.snoope"/>
      <param name="qualitycutoff" value="20"/>
      <param name="lengthofbasetocheckquality" value="20"/>
      <output name="Leftflanking" file="microsatellite_flanking_L.fastq"/>
      <output name="Rightflanking" file="microsatellite_flanking_R.fastq"/>
    </test>
    
  </tests>
  <help>


.. class:: infomark

**What it does**

This tool will fetch flanking regions around microsatellites, screen for quality score at microsatellites and adjacent flanking regions, and output two fastq files containing flanking regions in forward-forward direction.

- This tool assumes that the quality score is Phred+33, such as Sanger fastq.
- Reads that have either left or right flanking regions shorter than the length of flanking regions that require quality screening will be removed.

**Citation**
When you use this tool, please cite **Fungtammasan A, Ananda G, Hile SE, Su MS, Sun C, Harris R, Medvedev P, Eckert K, Makova KD. 2015. Accurate Typing of Short Tandem Repeats from Genome-wide Sequencing Data and its Applications, Genome Research**
 
**Input**

The input files need to be in the same format as output from **microsatellite detection program**. This format contains **length of repeat**, **length of left flanking region**, **length of right flanking region**, **repeat motif**, **hamming (editing) distance**, **read name**, **read sequence**, **read quality score**

**Output**

The output will be the two fastq files. The first file contains left flank regions. The second file contains right flanking regions.

**Example**

- Suppose we detected the microsatellites from short reads ::

	6	40	54	G	0	SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCTggggggTTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG	GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG?FFDFGGGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA
    

- We want to get fastq files of flanking regions around microsatellite with quality score at least 20 on Phred +33  
  
- Then the program will report these two fastq files ::

	@SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCT
	+SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG


	@SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	TTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG
	+SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
	GGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA
  


</help>
</tool>