Mercurial > repos > arkarachai-fungtammasan > microsatellite_ngs
diff fetchflank.xml @ 0:20ab85af9505
Uploaded
author | arkarachai-fungtammasan |
---|---|
date | Fri, 03 Oct 2014 20:54:30 -0400 |
parents | |
children | b27006b0a953 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fetchflank.xml Fri Oct 03 20:54:30 2014 -0400 @@ -0,0 +1,73 @@ +<tool id="fetchflank" name="Fetch flanking bases" version="1.0.0"> + <description> of microsatellites and output as two fastq files in forward-forward orientation</description> + <command interpreter="python">pair_fetch_DNA_ff.py $microsat_in_read $Leftflanking $Rightflanking $qualitycutoff $lengthofbasetocheckquality </command> + + <inputs> + <param name="microsat_in_read" type="data" label="Select data of microsatellites in reads" /> + <param name="qualitycutoff" type="integer" value="20" label="Minimum quality score (Phred+33) for microsatellites and flanking regions" /> + <param name="lengthofbasetocheckquality" type="integer" value="20" label="Length of flanking regions that require quality screening" /> + </inputs> + <outputs> + <data format="fastq" name="Leftflanking" /> + <data format="fastq" name="Rightflanking" /> + </outputs> + <tests> + <!-- Test data with valid values --> + <test> + <param name="microsat_in_read" value="samplefq.snoope"/> + <param name="qualitycutoff" value="20"/> + <param name="lengthofbasetocheckquality" value="20"/> + <output name="Leftflanking" file="microsatellite_flanking_L.fastq"/> + <output name="Rightflanking" file="microsatellite_flanking_R.fastq"/> + </test> + + </tests> + <help> + + +.. class:: infomark + +**What it does** + +This tool will fetch flanking regions around microsatellites, screen for quality score at microsatellites and adjacent flanking regions, and output two fastq files containing flanking regions in forward-forward direction. + +- This tool assumes that the quality score is Phred+33, such as Sanger fastq. +- Reads that have either left or right flanking regions shorter than the length of flanking regions that require quality screening will be removed. + +**Citation** +When you use this tool, please cite **Arkarachai Fungtammasan and Guruprasad Ananda (2014).** + +**Input** + +The input files need to be in the same format as output from **microsatellite detection program**. This format contains **length of repeat**, **length of left flanking region**, **length of right flanking region**, **repeat motif**, **hamming (editing) distance**, **read name**, **read sequence**, **read quality score** + +**Output** + +The output will be the two fastq files. The first file contains left flank regions. The second file contains right flanking regions. + +**Example** + +- Suppose we detected the microsatellites from short reads :: + + 6 40 54 G 0 SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1 TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCTggggggTTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG?FFDFGGGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA + + +- We want to get fastq files of flanking regions around microsatellite with quality score at least 20 on Phred +33 + +- Then the program will report these two fastq files :: + + @SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1 + TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCT + +SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1 + GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG + + + @SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1 + TTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG + +SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1 + GGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA + + + +</help> +</tool> \ No newline at end of file