--- a/fetchflank.xml	Wed Apr 01 17:06:29 2015 -0400
+++ b/fetchflank.xml	Wed Apr 22 12:48:40 2015 -0400
@@ -1,5 +1,5 @@
-<tool id="fetchflank" name="Fetch flanking bases" version="1.0.0">
-  <description> of microsatellites and output as two fastq files in forward-forward orientation</description>
+<tool id="fetchflank" name="Fetch bases flanking" version="1.0.0">
+  <description> the STRs in the reads and output two fastq files in forward-forward orientation</description>
   <command interpreter="python">pair_fetch_DNA_ff.py  $microsat_in_read $Leftflanking $Rightflanking $qualitycutoff $lengthofbasetocheckquality  </command>
 
   <inputs>
@@ -29,7 +29,7 @@
 
 **What it does**
 
-This tool will fetch flanking regions around microsatellites, screen for quality score at microsatellites and adjacent flanking regions, and output two fastq files containing flanking regions in forward-forward direction.
+This tool will fetch flanking regions around STRs from the reads output by "STR detection" step, screen for quality score at STRs and adjacent flanking regions, and output two fastq files containing flanking regions in forward-forward direction.
 
 - This tool assumes that the quality score is Phred+33, such as Sanger fastq.
 - Reads that have either left or right flanking regions shorter than the length of flanking regions that require quality screening will be removed.
@@ -39,22 +39,20 @@
  
 **Input**
 
-The input files need to be in the same format as output from **microsatellite detection program**. This format contains **length of repeat**, **length of left flanking region**, **length of right flanking region**, **repeat motif**, **hamming (editing) distance**, **read name**, **read sequence**, **read quality score**
+The input file needs to be in the same format as output from **STR detection** step. This format contains **length of repeat**, **length of left flanking region**, **length of right flanking region**, **repeat motif**, **hamming (editing) distance**, **read name**, **read sequence**, **read quality score**
 
 **Output**
 
-The output will be the two fastq files. The first file contains left flank regions. The second file contains right flanking regions.
+The output will be two fastq files. The first file contains left flanking bases. The second file contains right flanking bases.
 
 **Example**
 
-- Suppose we detected the microsatellites from short reads ::
+- Starting with this test input ::
 
 	6	40	54	G	0	SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCTggggggTTCTTGACTCCTCTGAATGGGTACGGGAGTGTGGACCTCAGGGAGGCCCCCTTG	GGGGGGGGGGGGGGGGGFGGGGGGGGGFEGGGGGGGGGGG?FFDFGGGGGG?FFFGGGGGDEGGEFFBEFCEEBD@BACB*?=99(/=5'6=4:CCC*AA
     
 
-- We want to get fastq files of flanking regions around microsatellite with quality score at least 20 on Phred +33  
-  
-- Then the program will report these two fastq files ::
+- If we want to get fastq files of flanking regions around the detected STRs with quality score of at least 20, the program will report these two fastq files ::
 
 	@SRR345592.75000006 HS2000-192_107:1:63:5822:176818_1_per1_1
 	TACCCTCCTGTCTTCCCAGACTGATTTCTGTTCCTGCCCT