Mercurial > repos > artbio > metavisitor_2_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga @ 0:c375489bbcb0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author artbio
date Sun, 21 Jul 2019 19:22:52 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:c375489bbcb0
1 {
2 "a_galaxy_workflow": "true",
3 "uuid": "1187ab6d-a4f6-4ee7-817c-d12db902fed7",
4 "tags": [],
5 "format-version": "0.1",
6 "version": 3,
7 "steps": {
8 "11": {
9 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0",
10 "errors": null,
11 "uuid": "bd3f2dd0-b170-433d-b1e8-2b0f303006a7",
12 "tool_version": "2.0.0",
13 "outputs": [
14 {
15 "type": "fasta",
16 "name": "contigsandsinglets"
17 },
18 {
19 "type": "txt",
20 "name": "cap3stdout"
21 },
22 {
23 "type": "fasta",
24 "name": "contigs"
25 },
26 {
27 "type": "txt",
28 "name": "contigsqual"
29 },
30 {
31 "type": "txt",
32 "name": "contigslink"
33 },
34 {
35 "type": "txt",
36 "name": "ace"
37 },
38 {
39 "type": "txt",
40 "name": "info"
41 },
42 {
43 "type": "txt",
44 "name": "singlets"
45 }
46 ],
47 "post_job_actions": {
48 "HideDatasetActioninfo": {
49 "output_name": "info",
50 "action_type": "HideDatasetAction",
51 "action_arguments": {}
52 },
53 "HideDatasetActioncontigsqual": {
54 "output_name": "contigsqual",
55 "action_type": "HideDatasetAction",
56 "action_arguments": {}
57 },
58 "RenameDatasetActioncontigsandsinglets": {
59 "output_name": "contigsandsinglets",
60 "action_type": "RenameDatasetAction",
61 "action_arguments": {
62 "newname": "CAP3 assembled contigs"
63 }
64 },
65 "HideDatasetActioncontigslink": {
66 "output_name": "contigslink",
67 "action_type": "HideDatasetAction",
68 "action_arguments": {}
69 },
70 "HideDatasetActioncontigs": {
71 "output_name": "contigs",
72 "action_type": "HideDatasetAction",
73 "action_arguments": {}
74 },
75 "HideDatasetActioncap3stdout": {
76 "output_name": "cap3stdout",
77 "action_type": "HideDatasetAction",
78 "action_arguments": {}
79 },
80 "HideDatasetActionsinglets": {
81 "output_name": "singlets",
82 "action_type": "HideDatasetAction",
83 "action_arguments": {}
84 },
85 "HideDatasetActionace": {
86 "output_name": "ace",
87 "action_type": "HideDatasetAction",
88 "action_arguments": {}
89 }
90 },
91 "workflow_outputs": [
92 {
93 "output_name": "contigsandsinglets",
94 "uuid": "e2dff9ee-9235-4087-9a51-30b5b9974537",
95 "label": null
96 }
97 ],
98 "annotation": "",
99 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0",
100 "input_connections": {
101 "inputSequences": {
102 "output_name": "fastaOutput",
103 "id": 10
104 }
105 },
106 "inputs": [
107 {
108 "name": "inputSequences",
109 "description": "runtime parameter for tool cap3"
110 }
111 ],
112 "position": {
113 "top": 633,
114 "left": 2061.5
115 },
116 "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}",
117 "label": "CAP3 to re-assembe contigs",
118 "type": "tool",
119 "id": 11,
120 "tool_shed_repository": {
121 "owner": "artbio",
122 "changeset_revision": "d76a0d8a9eac",
123 "name": "cap3",
124 "tool_shed": "toolshed.g2.bx.psu.edu"
125 },
126 "name": "cap3"
127 },
128 "10": {
129 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1",
130 "errors": null,
131 "uuid": "bac749b9-96e4-4a92-baac-cd160c09f9ec",
132 "tool_version": "2.6.1",
133 "outputs": [
134 {
135 "type": "tabular",
136 "name": "tabularOutput"
137 },
138 {
139 "type": "fasta",
140 "name": "fastaOutput"
141 },
142 {
143 "type": "fasta",
144 "name": "al_sequences"
145 },
146 {
147 "type": "fasta",
148 "name": "un_sequences"
149 }
150 ],
151 "post_job_actions": {
152 "RenameDatasetActionfastaOutput": {
153 "output_name": "fastaOutput",
154 "action_type": "RenameDatasetAction",
155 "action_arguments": {
156 "newname": "Assembled contigs hitting viral database"
157 }
158 },
159 "HideDatasetActional_sequences": {
160 "output_name": "al_sequences",
161 "action_type": "HideDatasetAction",
162 "action_arguments": {}
163 },
164 "HideDatasetActionun_sequences": {
165 "output_name": "un_sequences",
166 "action_type": "HideDatasetAction",
167 "action_arguments": {}
168 }
169 },
170 "workflow_outputs": [
171 {
172 "output_name": "tabularOutput",
173 "uuid": "f858a698-d9dd-4cc2-a047-6664b0519271",
174 "label": null
175 },
176 {
177 "output_name": "fastaOutput",
178 "uuid": "d9c341c8-d826-4633-a6a5-9462677092d8",
179 "label": null
180 }
181 ],
182 "annotation": "",
183 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1",
184 "input_connections": {
185 "blast": {
186 "output_name": "output1",
187 "id": 9
188 },
189 "sequences": {
190 "output_name": "transcripts",
191 "id": 8
192 }
193 },
194 "inputs": [
195 {
196 "name": "blast",
197 "description": "runtime parameter for tool Parse blast output and compile hits"
198 },
199 {
200 "name": "sequences",
201 "description": "runtime parameter for tool Parse blast output and compile hits"
202 }
203 ],
204 "position": {
205 "top": 404,
206 "left": 1740
207 },
208 "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
209 "label": "Get viral contigs",
210 "type": "tool",
211 "id": 10,
212 "tool_shed_repository": {
213 "owner": "artbio",
214 "changeset_revision": "b4c9c085d709",
215 "name": "blastparser_and_hits",
216 "tool_shed": "toolshed.g2.bx.psu.edu"
217 },
218 "name": "Parse blast output and compile hits"
219 },
220 "13": {
221 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0",
222 "errors": null,
223 "uuid": "7f0913f8-f7f9-4ba3-878c-9c502460331d",
224 "tool_version": "1.0.0",
225 "outputs": [
226 {
227 "type": "fasta",
228 "name": "output"
229 }
230 ],
231 "post_job_actions": {
232 "HideDatasetActionoutput": {
233 "output_name": "output",
234 "action_type": "HideDatasetAction",
235 "action_arguments": {}
236 },
237 "RenameDatasetActionoutput": {
238 "output_name": "output",
239 "action_type": "RenameDatasetAction",
240 "action_arguments": {
241 "newname": "generated CDS"
242 }
243 }
244 },
245 "workflow_outputs": [],
246 "annotation": "Generate CDS from aligned contigs",
247 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0",
248 "input_connections": {
249 "guideSequence": {
250 "output_name": "outfile",
251 "id": 2
252 },
253 "blast_tab": {
254 "output_name": "output1",
255 "id": 12
256 },
257 "sequences": {
258 "output_name": "contigsandsinglets",
259 "id": 11
260 }
261 },
262 "inputs": [
263 {
264 "name": "guideSequence",
265 "description": "runtime parameter for tool blast_to_scaffold"
266 },
267 {
268 "name": "blast_tab",
269 "description": "runtime parameter for tool blast_to_scaffold"
270 },
271 {
272 "name": "sequences",
273 "description": "runtime parameter for tool blast_to_scaffold"
274 }
275 ],
276 "position": {
277 "top": 669,
278 "left": 2728.5
279 },
280 "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
281 "label": "Generate CDS",
282 "type": "tool",
283 "id": 13,
284 "tool_shed_repository": {
285 "owner": "artbio",
286 "changeset_revision": "7d96b28eec49",
287 "name": "blast_to_scaffold",
288 "tool_shed": "toolshed.g2.bx.psu.edu"
289 },
290 "name": "blast_to_scaffold"
291 },
292 "12": {
293 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
294 "errors": null,
295 "uuid": "4f996123-d155-426a-ba26-e649c422431e",
296 "tool_version": "0.3.1",
297 "outputs": [
298 {
299 "type": "tabular",
300 "name": "output1"
301 }
302 ],
303 "post_job_actions": {
304 "HideDatasetActionoutput1": {
305 "output_name": "output1",
306 "action_type": "HideDatasetAction",
307 "action_arguments": {}
308 },
309 "RenameDatasetActionoutput1": {
310 "output_name": "output1",
311 "action_type": "RenameDatasetAction",
312 "action_arguments": {
313 "newname": "Contigs aligned to ${ncbi_guide_ID}"
314 }
315 }
316 },
317 "workflow_outputs": [],
318 "annotation": "",
319 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
320 "input_connections": {
321 "query": {
322 "output_name": "contigsandsinglets",
323 "id": 11
324 },
325 "db_opts|histdb": {
326 "output_name": "outfile",
327 "id": 4
328 }
329 },
330 "inputs": [
331 {
332 "name": "db_opts",
333 "description": "runtime parameter for tool NCBI BLAST+ blastn"
334 },
335 {
336 "name": "query",
337 "description": "runtime parameter for tool NCBI BLAST+ blastn"
338 }
339 ],
340 "position": {
341 "top": 837,
342 "left": 2402
343 },
344 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
345 "label": "Blast contigs to specific virus database",
346 "type": "tool",
347 "id": 12,
348 "tool_shed_repository": {
349 "owner": "devteam",
350 "changeset_revision": "e25d3acf6e68",
351 "name": "ncbi_blast_plus",
352 "tool_shed": "toolshed.g2.bx.psu.edu"
353 },
354 "name": "NCBI BLAST+ blastn"
355 },
356 "14": {
357 "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0",
358 "errors": null,
359 "uuid": "c81173fb-317d-4c00-9da8-f0072b62a569",
360 "tool_version": "1.0.0",
361 "outputs": [
362 {
363 "type": "input",
364 "name": "out_file1"
365 }
366 ],
367 "post_job_actions": {
368 "ChangeDatatypeActionout_file1": {
369 "output_name": "out_file1",
370 "action_type": "ChangeDatatypeAction",
371 "action_arguments": {
372 "newtype": "fasta"
373 }
374 },
375 "RenameDatasetActionout_file1": {
376 "output_name": "out_file1",
377 "action_type": "RenameDatasetAction",
378 "action_arguments": {
379 "newname": "Nora_MV_${ncbi_guide_ID}_guided"
380 }
381 }
382 },
383 "workflow_outputs": [
384 {
385 "output_name": "out_file1",
386 "uuid": "e202eeb0-f65c-4295-afe0-44a56634a452",
387 "label": null
388 }
389 ],
390 "annotation": "",
391 "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0",
392 "input_connections": {
393 "input": {
394 "output_name": "output",
395 "id": 13
396 }
397 },
398 "inputs": [
399 {
400 "name": "input",
401 "description": "runtime parameter for tool Regex Find And Replace"
402 }
403 ],
404 "position": {
405 "top": 927,
406 "left": 2971
407 },
408 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_MV\\\"}]\", \"__page__\": null}",
409 "label": "Change CDS header",
410 "type": "tool",
411 "id": 14,
412 "tool_shed_repository": {
413 "owner": "galaxyp",
414 "changeset_revision": "209b7c5ee9d7",
415 "name": "regex_find_replace",
416 "tool_shed": "toolshed.g2.bx.psu.edu"
417 },
418 "name": "Regex Find And Replace"
419 },
420 "1": {
421 "tool_id": null,
422 "errors": null,
423 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
424 "tool_version": null,
425 "outputs": [],
426 "workflow_outputs": [
427 {
428 "output_name": "output",
429 "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143",
430 "label": null
431 }
432 ],
433 "annotation": "",
434 "content_id": null,
435 "input_connections": {},
436 "inputs": [],
437 "position": {
438 "top": 976.9833374023438,
439 "left": 1205.9666748046875
440 },
441 "tool_state": "{}",
442 "label": "viral nucleotide BLAST database (V2)",
443 "type": "data_input",
444 "id": 1,
445 "name": "Input dataset"
446 },
447 "0": {
448 "tool_id": null,
449 "errors": null,
450 "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61",
451 "tool_version": null,
452 "outputs": [],
453 "workflow_outputs": [
454 {
455 "output_name": "output",
456 "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94",
457 "label": null
458 }
459 ],
460 "annotation": "",
461 "content_id": null,
462 "input_connections": {},
463 "inputs": [],
464 "position": {
465 "top": 163,
466 "left": 200
467 },
468 "tool_state": "{\"collection_type\": \"list\"}",
469 "label": "Fastq files",
470 "type": "data_collection_input",
471 "id": 0,
472 "name": "Input dataset collection"
473 },
474 "3": {
475 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
476 "errors": null,
477 "uuid": "41212793-f400-4bd6-9827-c083025f3e01",
478 "tool_version": "2.3.0",
479 "outputs": [
480 {
481 "type": "input",
482 "name": "output"
483 }
484 ],
485 "post_job_actions": {
486 "RenameDatasetActionoutput": {
487 "output_name": "output",
488 "action_type": "RenameDatasetAction",
489 "action_arguments": {
490 "newname": "#{input} clipped"
491 }
492 }
493 },
494 "workflow_outputs": [
495 {
496 "output_name": "output",
497 "uuid": "3939be31-c091-4dbe-86a7-fd05c01f9598",
498 "label": null
499 }
500 ],
501 "annotation": "",
502 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
503 "input_connections": {
504 "input": {
505 "output_name": "output",
506 "id": 0
507 }
508 },
509 "inputs": [
510 {
511 "name": "input",
512 "description": "runtime parameter for tool Clip adapter"
513 }
514 ],
515 "position": {
516 "top": 318,
517 "left": 364.5
518 },
519 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}",
520 "label": null,
521 "type": "tool",
522 "id": 3,
523 "tool_shed_repository": {
524 "owner": "artbio",
525 "changeset_revision": "f7947c5a18b8",
526 "name": "yac_clipper",
527 "tool_shed": "toolshed.g2.bx.psu.edu"
528 },
529 "name": "Clip adapter"
530 },
531 "2": {
532 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0",
533 "errors": null,
534 "uuid": "13214523-9fb0-4e23-8cdf-f389331ba0c9",
535 "tool_version": "2.3.0",
536 "outputs": [
537 {
538 "type": "fasta",
539 "name": "outfile"
540 },
541 {
542 "type": "txt",
543 "name": "logfile"
544 }
545 ],
546 "post_job_actions": {
547 "HideDatasetActionlogfile": {
548 "output_name": "logfile",
549 "action_type": "HideDatasetAction",
550 "action_arguments": {}
551 },
552 "RenameDatasetActionoutfile": {
553 "output_name": "outfile",
554 "action_type": "RenameDatasetAction",
555 "action_arguments": {
556 "newname": "${ncbi_guide_ID}"
557 }
558 }
559 },
560 "workflow_outputs": [
561 {
562 "output_name": "outfile",
563 "uuid": "9c9b23f2-66ae-4eeb-88f1-e4a0a8bd596b",
564 "label": null
565 }
566 ],
567 "annotation": "",
568 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0",
569 "input_connections": {},
570 "inputs": [],
571 "position": {
572 "top": 1043,
573 "left": 1750
574 },
575 "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}",
576 "label": null,
577 "type": "tool",
578 "id": 2,
579 "tool_shed_repository": {
580 "owner": "artbio",
581 "changeset_revision": "c667d0ee39f5",
582 "name": "fetch_fasta_from_ncbi",
583 "tool_shed": "toolshed.g2.bx.psu.edu"
584 },
585 "name": "Retrieve FASTA from NCBI"
586 },
587 "5": {
588 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
589 "errors": null,
590 "uuid": "02a6f0a8-8f83-4b0f-85ad-0370a5753a13",
591 "tool_version": "1.4.1",
592 "outputs": [
593 {
594 "type": "input",
595 "name": "paired_output"
596 },
597 {
598 "type": "input",
599 "name": "list_output"
600 },
601 {
602 "type": "input",
603 "name": "out_file1"
604 },
605 {
606 "type": "_sniff_",
607 "name": "paired_out_file"
608 }
609 ],
610 "post_job_actions": {
611 "HideDatasetActionpaired_out_file": {
612 "output_name": "paired_out_file",
613 "action_type": "HideDatasetAction",
614 "action_arguments": {}
615 },
616 "RenameDatasetActionout_file1": {
617 "output_name": "out_file1",
618 "action_type": "RenameDatasetAction",
619 "action_arguments": {
620 "newname": "#{global_condition.inputs} concatenated"
621 }
622 },
623 "HideDatasetActionpaired_output": {
624 "output_name": "paired_output",
625 "action_type": "HideDatasetAction",
626 "action_arguments": {}
627 },
628 "HideDatasetActionout_file1": {
629 "output_name": "out_file1",
630 "action_type": "HideDatasetAction",
631 "action_arguments": {}
632 },
633 "HideDatasetActionlist_output": {
634 "output_name": "list_output",
635 "action_type": "HideDatasetAction",
636 "action_arguments": {}
637 }
638 },
639 "workflow_outputs": [],
640 "annotation": "",
641 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
642 "input_connections": {
643 "global_condition|inputs": {
644 "output_name": "output",
645 "id": 3
646 }
647 },
648 "inputs": [
649 {
650 "name": "global_condition",
651 "description": "runtime parameter for tool Concatenate multiple datasets"
652 }
653 ],
654 "position": {
655 "top": 492.5,
656 "left": 474
657 },
658 "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
659 "label": "Concatenate read files",
660 "type": "tool",
661 "id": 5,
662 "tool_shed_repository": {
663 "owner": "artbio",
664 "changeset_revision": "55cf9d9defd1",
665 "name": "concatenate_multiple_datasets",
666 "tool_shed": "toolshed.g2.bx.psu.edu"
667 },
668 "name": "Concatenate multiple datasets"
669 },
670 "4": {
671 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1",
672 "errors": null,
673 "uuid": "1a39e6e8-8079-4f7a-b4c2-2028e5dbc2dd",
674 "tool_version": "0.3.1",
675 "outputs": [
676 {
677 "type": "data",
678 "name": "outfile"
679 }
680 ],
681 "post_job_actions": {
682 "HideDatasetActionoutfile": {
683 "output_name": "outfile",
684 "action_type": "HideDatasetAction",
685 "action_arguments": {}
686 },
687 "RenameDatasetActionoutfile": {
688 "output_name": "outfile",
689 "action_type": "RenameDatasetAction",
690 "action_arguments": {
691 "newname": "#{input_file} blast database"
692 }
693 }
694 },
695 "workflow_outputs": [],
696 "annotation": "",
697 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1",
698 "input_connections": {
699 "input_file": {
700 "output_name": "outfile",
701 "id": 2
702 }
703 },
704 "inputs": [
705 {
706 "name": "mask_data_file",
707 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
708 },
709 {
710 "name": "input_file",
711 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb"
712 }
713 ],
714 "position": {
715 "top": 1060,
716 "left": 2100.5
717 },
718 "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}",
719 "label": "Make a blast database",
720 "type": "tool",
721 "id": 4,
722 "tool_shed_repository": {
723 "owner": "devteam",
724 "changeset_revision": "e25d3acf6e68",
725 "name": "ncbi_blast_plus",
726 "tool_shed": "toolshed.g2.bx.psu.edu"
727 },
728 "name": "NCBI BLAST+ makeblastdb"
729 },
730 "7": {
731 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
732 "errors": null,
733 "uuid": "62876927-ee09-4764-95eb-d86548fdce73",
734 "tool_version": "2.1.1",
735 "outputs": [
736 {
737 "type": "tabular",
738 "name": "output"
739 },
740 {
741 "type": "input",
742 "name": "aligned"
743 },
744 {
745 "type": "input",
746 "name": "unaligned"
747 }
748 ],
749 "post_job_actions": {
750 "HideDatasetActionaligned": {
751 "output_name": "aligned",
752 "action_type": "HideDatasetAction",
753 "action_arguments": {}
754 },
755 "HideDatasetActionoutput": {
756 "output_name": "output",
757 "action_type": "HideDatasetAction",
758 "action_arguments": {}
759 },
760 "RenameDatasetActionunaligned": {
761 "output_name": "unaligned",
762 "action_type": "RenameDatasetAction",
763 "action_arguments": {
764 "newname": "Non D. melanogaster sequences"
765 }
766 }
767 },
768 "workflow_outputs": [
769 {
770 "output_name": "unaligned",
771 "uuid": "608ff661-018b-44c2-b020-59b31c5ff2d4",
772 "label": null
773 }
774 ],
775 "annotation": "Align reads to host (dm6) genome.\nThe unaligned reads will most likely have a viral source.",
776 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
777 "input_connections": {
778 "input": {
779 "output_name": "output",
780 "id": 6
781 }
782 },
783 "inputs": [
784 {
785 "name": "input",
786 "description": "runtime parameter for tool sR_bowtie"
787 }
788 ],
789 "position": {
790 "top": 238,
791 "left": 952
792 },
793 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}",
794 "label": "Get non-host sequences",
795 "type": "tool",
796 "id": 7,
797 "tool_shed_repository": {
798 "owner": "artbio",
799 "changeset_revision": "0281bb245635",
800 "name": "sr_bowtie",
801 "tool_shed": "toolshed.g2.bx.psu.edu"
802 },
803 "name": "sR_bowtie"
804 },
805 "6": {
806 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1",
807 "errors": null,
808 "uuid": "e693b793-ae94-42c8-9f59-4b4b847aa4b1",
809 "tool_version": "2.1.1",
810 "outputs": [
811 {
812 "type": "fasta",
813 "name": "output"
814 }
815 ],
816 "post_job_actions": {
817 "RenameDatasetActionoutput": {
818 "output_name": "output",
819 "action_type": "RenameDatasetAction",
820 "action_arguments": {
821 "newname": "Initial Clipped sequences"
822 }
823 }
824 },
825 "workflow_outputs": [
826 {
827 "output_name": "output",
828 "uuid": "b81a3224-0d3e-4dec-996f-5fa3d525cabd",
829 "label": null
830 }
831 ],
832 "annotation": "",
833 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1",
834 "input_connections": {
835 "input": {
836 "output_name": "out_file1",
837 "id": 5
838 }
839 },
840 "inputs": [
841 {
842 "name": "input",
843 "description": "runtime parameter for tool sequence_format_converter"
844 }
845 ],
846 "position": {
847 "top": 621,
848 "left": 787.5
849 },
850 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}",
851 "label": "Change sequence format to weighted fasta",
852 "type": "tool",
853 "id": 6,
854 "tool_shed_repository": {
855 "owner": "artbio",
856 "changeset_revision": "f1d59113125a",
857 "name": "sequence_format_converter",
858 "tool_shed": "toolshed.g2.bx.psu.edu"
859 },
860 "name": "sequence_format_converter"
861 },
862 "9": {
863 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
864 "errors": null,
865 "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135",
866 "tool_version": "0.3.1",
867 "outputs": [
868 {
869 "type": "tabular",
870 "name": "output1"
871 }
872 ],
873 "post_job_actions": {
874 "HideDatasetActionoutput1": {
875 "output_name": "output1",
876 "action_type": "HideDatasetAction",
877 "action_arguments": {}
878 }
879 },
880 "workflow_outputs": [],
881 "annotation": "Align the assembled transcripts to the viral database to filter out non-viral sequences.",
882 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
883 "input_connections": {
884 "query": {
885 "output_name": "transcripts",
886 "id": 8
887 },
888 "db_opts|histdb": {
889 "output_name": "output",
890 "id": 1
891 }
892 },
893 "inputs": [
894 {
895 "name": "db_opts",
896 "description": "runtime parameter for tool NCBI BLAST+ blastn"
897 },
898 {
899 "name": "query",
900 "description": "runtime parameter for tool NCBI BLAST+ blastn"
901 }
902 ],
903 "position": {
904 "top": 690,
905 "left": 1455
906 },
907 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
908 "label": "BLASTn contigs to the viral database",
909 "type": "tool",
910 "id": 9,
911 "tool_shed_repository": {
912 "owner": "devteam",
913 "changeset_revision": "e25d3acf6e68",
914 "name": "ncbi_blast_plus",
915 "tool_shed": "toolshed.g2.bx.psu.edu"
916 },
917 "name": "NCBI BLAST+ blastn"
918 },
919 "8": {
920 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2",
921 "errors": null,
922 "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9",
923 "tool_version": "1.2.2",
924 "outputs": [
925 {
926 "type": "fasta",
927 "name": "transcripts"
928 }
929 ],
930 "post_job_actions": {
931 "ChangeDatatypeActiontranscripts": {
932 "output_name": "transcripts",
933 "action_type": "ChangeDatatypeAction",
934 "action_arguments": {
935 "newtype": "fasta"
936 }
937 },
938 "RenameDatasetActiontranscripts": {
939 "output_name": "transcripts",
940 "action_type": "RenameDatasetAction",
941 "action_arguments": {
942 "newname": "Oases Contigs"
943 }
944 }
945 },
946 "workflow_outputs": [
947 {
948 "output_name": "transcripts",
949 "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e",
950 "label": null
951 }
952 ],
953 "annotation": "",
954 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2",
955 "input_connections": {
956 "inputs_0|input": {
957 "output_name": "unaligned",
958 "id": 7
959 }
960 },
961 "inputs": [],
962 "position": {
963 "top": 442,
964 "left": 1287
965 },
966 "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
967 "label": "Assemble contigs",
968 "type": "tool",
969 "id": 8,
970 "tool_shed_repository": {
971 "owner": "artbio",
972 "changeset_revision": "f7dd852c8f4c",
973 "name": "oases",
974 "tool_shed": "toolshed.g2.bx.psu.edu"
975 },
976 "name": "Oases_optimiser"
977 }
978 },
979 "annotation": "",
980 "name": "Metavisitor: Workflow for Use Case 1-1"
981 }