Mercurial > repos > artbio > metavisitor_2_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga @ 0:c375489bbcb0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author artbio
date Sun, 21 Jul 2019 19:22:52 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:c375489bbcb0
1 {
2 "a_galaxy_workflow": "true",
3 "uuid": "b7c51d51-7234-4834-b3d7-a3f1c514ce02",
4 "tags": [],
5 "format-version": "0.1",
6 "version": 3,
7 "steps": {
8 "1": {
9 "tool_id": null,
10 "errors": null,
11 "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902",
12 "tool_version": null,
13 "outputs": [],
14 "workflow_outputs": [
15 {
16 "output_name": "output",
17 "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac",
18 "label": null
19 }
20 ],
21 "annotation": "",
22 "content_id": null,
23 "input_connections": {},
24 "inputs": [
25 {
26 "name": "AnCV genome",
27 "description": ""
28 }
29 ],
30 "position": {
31 "top": 395.98333740234375,
32 "left": 595.9666748046875
33 },
34 "tool_state": "{\"name\": \"AnCV genome\"}",
35 "label": "AnCV genome",
36 "type": "data_input",
37 "id": 1,
38 "name": "Input dataset"
39 },
40 "0": {
41 "tool_id": null,
42 "errors": null,
43 "uuid": "35d6ef0f-98d0-439a-aef4-3d4d2c85e309",
44 "tool_version": null,
45 "outputs": [],
46 "workflow_outputs": [
47 {
48 "output_name": "output",
49 "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b",
50 "label": null
51 }
52 ],
53 "annotation": "",
54 "content_id": null,
55 "input_connections": {},
56 "inputs": [
57 {
58 "name": "Small Read fastq files",
59 "description": ""
60 }
61 ],
62 "position": {
63 "top": 345.51666259765625,
64 "left": 199.5333251953125
65 },
66 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Small Read fastq files\"}",
67 "label": "Small Read fastq files",
68 "type": "data_collection_input",
69 "id": 0,
70 "name": "Input dataset collection"
71 },
72 "3": {
73 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
74 "errors": null,
75 "uuid": "be271c94-4c7e-4370-bad0-bf4d714c51a7",
76 "tool_version": "1.4.1",
77 "outputs": [
78 {
79 "type": "input",
80 "name": "paired_output"
81 },
82 {
83 "type": "input",
84 "name": "list_output"
85 },
86 {
87 "type": "input",
88 "name": "out_file1"
89 },
90 {
91 "type": "_sniff_",
92 "name": "paired_out_file"
93 }
94 ],
95 "post_job_actions": {
96 "HideDatasetActionpaired_out_file": {
97 "output_name": "paired_out_file",
98 "action_type": "HideDatasetAction",
99 "action_arguments": {}
100 },
101 "HideDatasetActionlist_output": {
102 "output_name": "list_output",
103 "action_type": "HideDatasetAction",
104 "action_arguments": {}
105 },
106 "HideDatasetActionout_file1": {
107 "output_name": "out_file1",
108 "action_type": "HideDatasetAction",
109 "action_arguments": {}
110 },
111 "HideDatasetActionpaired_output": {
112 "output_name": "paired_output",
113 "action_type": "HideDatasetAction",
114 "action_arguments": {}
115 }
116 },
117 "workflow_outputs": [],
118 "annotation": "",
119 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
120 "input_connections": {
121 "global_condition|inputs": {
122 "output_name": "output",
123 "id": 2
124 }
125 },
126 "inputs": [
127 {
128 "name": "global_condition",
129 "description": "runtime parameter for tool Concatenate multiple datasets"
130 }
131 ],
132 "position": {
133 "top": 156.5,
134 "left": 521
135 },
136 "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
137 "label": null,
138 "type": "tool",
139 "id": 3,
140 "tool_shed_repository": {
141 "owner": "artbio",
142 "changeset_revision": "55cf9d9defd1",
143 "name": "concatenate_multiple_datasets",
144 "tool_shed": "toolshed.g2.bx.psu.edu"
145 },
146 "name": "Concatenate multiple datasets"
147 },
148 "2": {
149 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
150 "errors": null,
151 "uuid": "4d773707-d5ed-48c2-b9d2-334f32e2e1f7",
152 "tool_version": "2.3.0",
153 "outputs": [
154 {
155 "type": "input",
156 "name": "output"
157 }
158 ],
159 "post_job_actions": {
160 "HideDatasetActionoutput": {
161 "output_name": "output",
162 "action_type": "HideDatasetAction",
163 "action_arguments": {}
164 }
165 },
166 "workflow_outputs": [],
167 "annotation": "",
168 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
169 "input_connections": {
170 "input": {
171 "output_name": "output",
172 "id": 0
173 }
174 },
175 "inputs": [
176 {
177 "name": "input",
178 "description": "runtime parameter for tool Clip adapter"
179 }
180 ],
181 "position": {
182 "top": 462.5333251953125,
183 "left": 387.51666259765625
184 },
185 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}",
186 "label": null,
187 "type": "tool",
188 "id": 2,
189 "tool_shed_repository": {
190 "owner": "artbio",
191 "changeset_revision": "f7947c5a18b8",
192 "name": "yac_clipper",
193 "tool_shed": "toolshed.g2.bx.psu.edu"
194 },
195 "name": "Clip adapter"
196 },
197 "5": {
198 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
199 "errors": null,
200 "uuid": "91a11662-d2cc-410b-baf3-c684396a992f",
201 "tool_version": "2.1.1",
202 "outputs": [
203 {
204 "type": "tabular",
205 "name": "output"
206 },
207 {
208 "type": "input",
209 "name": "aligned"
210 },
211 {
212 "type": "input",
213 "name": "unaligned"
214 }
215 ],
216 "post_job_actions": {
217 "HideDatasetActionunaligned": {
218 "output_name": "unaligned",
219 "action_type": "HideDatasetAction",
220 "action_arguments": {}
221 },
222 "HideDatasetActionaligned": {
223 "output_name": "aligned",
224 "action_type": "HideDatasetAction",
225 "action_arguments": {}
226 },
227 "HideDatasetActionoutput": {
228 "output_name": "output",
229 "action_type": "HideDatasetAction",
230 "action_arguments": {}
231 }
232 },
233 "workflow_outputs": [],
234 "annotation": "",
235 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
236 "input_connections": {
237 "input": {
238 "output_name": "out_file1",
239 "id": 3
240 },
241 "refGenomeSource|ownFile": {
242 "output_name": "output",
243 "id": 1
244 }
245 },
246 "inputs": [
247 {
248 "name": "input",
249 "description": "runtime parameter for tool sR_bowtie"
250 },
251 {
252 "name": "refGenomeSource",
253 "description": "runtime parameter for tool sR_bowtie"
254 }
255 ],
256 "position": {
257 "top": 610,
258 "left": 882
259 },
260 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"bam\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"multiple\\\"\"}",
261 "label": null,
262 "type": "tool",
263 "id": 5,
264 "tool_shed_repository": {
265 "owner": "artbio",
266 "changeset_revision": "0281bb245635",
267 "name": "sr_bowtie",
268 "tool_shed": "toolshed.g2.bx.psu.edu"
269 },
270 "name": "sR_bowtie"
271 },
272 "4": {
273 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
274 "errors": null,
275 "uuid": "89c2c404-f8dc-4a86-87a3-173b3757fa42",
276 "tool_version": "2.1.1",
277 "outputs": [
278 {
279 "type": "tabular",
280 "name": "output"
281 },
282 {
283 "type": "input",
284 "name": "aligned"
285 },
286 {
287 "type": "input",
288 "name": "unaligned"
289 }
290 ],
291 "post_job_actions": {
292 "HideDatasetActionunaligned": {
293 "output_name": "unaligned",
294 "action_type": "HideDatasetAction",
295 "action_arguments": {}
296 },
297 "HideDatasetActionoutput": {
298 "output_name": "output",
299 "action_type": "HideDatasetAction",
300 "action_arguments": {}
301 },
302 "HideDatasetActionaligned": {
303 "output_name": "aligned",
304 "action_type": "HideDatasetAction",
305 "action_arguments": {}
306 }
307 },
308 "workflow_outputs": [],
309 "annotation": "",
310 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
311 "input_connections": {
312 "input": {
313 "output_name": "out_file1",
314 "id": 3
315 },
316 "refGenomeSource|ownFile": {
317 "output_name": "output",
318 "id": 1
319 }
320 },
321 "inputs": [
322 {
323 "name": "input",
324 "description": "runtime parameter for tool sR_bowtie"
325 },
326 {
327 "name": "refGenomeSource",
328 "description": "runtime parameter for tool sR_bowtie"
329 }
330 ],
331 "position": {
332 "top": 185,
333 "left": 875
334 },
335 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"multiple\\\"\"}",
336 "label": null,
337 "type": "tool",
338 "id": 4,
339 "tool_shed_repository": {
340 "owner": "artbio",
341 "changeset_revision": "0281bb245635",
342 "name": "sr_bowtie",
343 "tool_shed": "toolshed.g2.bx.psu.edu"
344 },
345 "name": "sR_bowtie"
346 },
347 "7": {
348 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0",
349 "errors": null,
350 "uuid": "701a4814-5bb8-4d89-8b82-03f4a4bf613a",
351 "tool_version": "2.14.0",
352 "outputs": [
353 {
354 "type": "tabular",
355 "name": "output_tab"
356 },
357 {
358 "type": "bed",
359 "name": "output_bed"
360 },
361 {
362 "type": "tabular",
363 "name": "extra_output_tab"
364 },
365 {
366 "type": "pdf",
367 "name": "output_pdf"
368 }
369 ],
370 "post_job_actions": {
371 "HideDatasetActionextra_output_tab": {
372 "output_name": "extra_output_tab",
373 "action_type": "HideDatasetAction",
374 "action_arguments": {}
375 },
376 "HideDatasetActionoutput_tab": {
377 "output_name": "output_tab",
378 "action_type": "HideDatasetAction",
379 "action_arguments": {}
380 }
381 },
382 "workflow_outputs": [
383 {
384 "output_name": "output_bed",
385 "uuid": "ff2d5b5c-4046-4365-8aee-c1af2a61adcb",
386 "label": null
387 },
388 {
389 "output_name": "output_pdf",
390 "uuid": "2de820e3-5559-4411-93da-82d873980235",
391 "label": null
392 }
393 ],
394 "annotation": "",
395 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0",
396 "input_connections": {
397 "inputs": {
398 "output_name": "output",
399 "id": 5
400 }
401 },
402 "inputs": [
403 {
404 "name": "inputs",
405 "description": "runtime parameter for tool small_rna_maps"
406 }
407 ],
408 "position": {
409 "top": 654,
410 "left": 1231.5
411 },
412 "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}",
413 "label": null,
414 "type": "tool",
415 "id": 7,
416 "tool_shed_repository": {
417 "owner": "artbio",
418 "changeset_revision": "14adf24603b6",
419 "name": "small_rna_maps",
420 "tool_shed": "toolshed.g2.bx.psu.edu"
421 },
422 "name": "small_rna_maps"
423 },
424 "6": {
425 "tool_id": "wc_gnu",
426 "errors": null,
427 "uuid": "2af514d7-4b04-422b-95da-06bd475076aa",
428 "tool_version": "1.0.0",
429 "outputs": [
430 {
431 "type": "tabular",
432 "name": "out_file1"
433 }
434 ],
435 "post_job_actions": {
436 "RenameDatasetActionout_file1": {
437 "output_name": "out_file1",
438 "action_type": "RenameDatasetAction",
439 "action_arguments": {
440 "newname": "nbre of remapped reads"
441 }
442 }
443 },
444 "workflow_outputs": [
445 {
446 "output_name": "out_file1",
447 "uuid": "8eb9cd5a-06a8-4fd4-a102-4ffc28c569a5",
448 "label": null
449 }
450 ],
451 "annotation": "",
452 "content_id": "wc_gnu",
453 "input_connections": {
454 "input1": {
455 "output_name": "output",
456 "id": 4
457 }
458 },
459 "inputs": [
460 {
461 "name": "input1",
462 "description": "runtime parameter for tool Line/Word/Character count"
463 }
464 ],
465 "position": {
466 "top": 309,
467 "left": 1211.5
468 },
469 "tool_state": "{\"__page__\": null, \"include_header\": \"\\\"true\\\"\", \"input1\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}",
470 "label": null,
471 "type": "tool",
472 "id": 6,
473 "name": "Line/Word/Character count"
474 }
475 },
476 "annotation": "",
477 "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2"
478 }