Mercurial > repos > artbio > metavisitor_2_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga @ 0:c375489bbcb0 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
| author | artbio |
|---|---|
| date | Sun, 21 Jul 2019 19:22:52 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga Sun Jul 21 19:22:52 2019 -0400 @@ -0,0 +1,1315 @@ +{ + "a_galaxy_workflow": "true", + "uuid": "1a62d2ab-f807-4210-a42b-787a997a7c68", + "tags": [], + "format-version": "0.1", + "version": 2, + "steps": { + "11": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "errors": null, + "uuid": "25858b99-1fc3-420e-b26a-c26284f326b4", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "tabular", + "name": "output" + }, + { + "type": "input", + "name": "aligned" + }, + { + "type": "input", + "name": "unaligned" + } + ], + "post_job_actions": { + "HideDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionaligned": { + "output_name": "aligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Unaligned PhiX174" + } + } + }, + "workflow_outputs": [], + "annotation": "Get non PhiX174 rteads", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "input_connections": { + "input": { + "output_name": "unaligned", + "id": 10 + }, + "refGenomeSource|ownFile": { + "output_name": "output", + "id": 2 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sR_bowtie" + }, + { + "name": "refGenomeSource", + "description": "runtime parameter for tool sR_bowtie" + } + ], + "position": { + "top": 621, + "left": 1390 + }, + "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"k_option\\\"\"}", + "label": "Align to PhiX174", + "type": "tool", + "id": 11, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "0281bb245635", + "name": "sr_bowtie", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sR_bowtie" + }, + "10": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "errors": null, + "uuid": "1be6a79b-2f76-4ed7-b646-333b32cf4f1c", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "tabular", + "name": "output" + }, + { + "type": "input", + "name": "aligned" + }, + { + "type": "input", + "name": "unaligned" + } + ], + "post_job_actions": { + "HideDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionaligned": { + "output_name": "aligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "unmatched Plasmodium Berghei" + } + } + }, + "workflow_outputs": [], + "annotation": "Get non P. berghei reads", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "input_connections": { + "input": { + "output_name": "unaligned", + "id": 9 + }, + "refGenomeSource|ownFile": { + "output_name": "output", + "id": 1 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sR_bowtie" + }, + { + "name": "refGenomeSource", + "description": "runtime parameter for tool sR_bowtie" + } + ], + "position": { + "top": 422, + "left": 1387 + }, + "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"k_option\\\"\"}", + "label": "Align to P. berghei", + "type": "tool", + "id": 10, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "0281bb245635", + "name": "sr_bowtie", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sR_bowtie" + }, + "13": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", + "errors": null, + "uuid": "ef6dcb1b-f0e2-4b08-8cca-db32d4a2a46b", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "tabular", + "name": "output1" + } + ], + "post_job_actions": {}, + "workflow_outputs": [ + { + "output_name": "output1", + "uuid": "1b6bd5a4-2f7b-45ff-8688-00d88bcf34ab", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.3.1", + "input_connections": { + "query": { + "output_name": "transcripts", + "id": 12 + }, + "db_opts|histdb": { + "output_name": "output", + "id": 3 + } + }, + "inputs": [ + { + "name": "db_opts", + "description": "runtime parameter for tool NCBI BLAST+ blastx" + }, + { + "name": "query", + "description": "runtime parameter for tool NCBI BLAST+ blastx" + } + ], + "position": { + "top": 512, + "left": 2011.5 + }, + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Blast contigs to vir2", + "type": "tool", + "id": 13, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ blastx" + }, + "12": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", + "errors": null, + "uuid": "57290980-ede3-434e-a4ae-0f4b0c8c7fb6", + "tool_version": "1.2.2", + "outputs": [ + { + "type": "fasta", + "name": "transcripts" + } + ], + "post_job_actions": { + "RenameDatasetActiontranscripts": { + "output_name": "transcripts", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Oases Contigs" + } + } + }, + "workflow_outputs": [ + { + "output_name": "transcripts", + "uuid": "c9e506a0-bff1-45e3-832b-d281202405d0", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", + "input_connections": { + "inputs_0|input": { + "output_name": "unaligned", + "id": 11 + } + }, + "inputs": [], + "position": { + "top": 371, + "left": 1807 + }, + "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", + "label": "Assemble contigs", + "type": "tool", + "id": 12, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f7dd852c8f4c", + "name": "oases", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Oases_optimiser" + }, + "15": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", + "errors": null, + "uuid": "e7bd9226-a562-4b93-822b-6611d816d419", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Assembled contigs matching Drosophila C virus" + } + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", + "input_connections": { + "input": { + "output_name": "fastaOutput", + "id": 14 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Pick Fasta sequences" + } + ], + "position": { + "top": 406, + "left": 2656 + }, + "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Drosophila_C_virus\\\"\"}", + "label": "Get contigs matching Drosophila C virus", + "type": "tool", + "id": 15, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "e3aee4ba49c6", + "name": "cherry_pick_fasta", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Pick Fasta sequences" + }, + "14": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", + "errors": null, + "uuid": "01cac8bc-ae6e-4eb8-9141-a797ed27bd92", + "tool_version": "2.6.1", + "outputs": [ + { + "type": "tabular", + "name": "tabularOutput" + }, + { + "type": "fasta", + "name": "fastaOutput" + }, + { + "type": "fasta", + "name": "al_sequences" + }, + { + "type": "fasta", + "name": "un_sequences" + } + ], + "post_job_actions": { + "RenameDatasetActionfastaOutput": { + "output_name": "fastaOutput", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Assembled contigs matching vir2 sequences" + } + }, + "HideDatasetActional_sequences": { + "output_name": "al_sequences", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActiontabularOutput": { + "output_name": "tabularOutput", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Assembled contigs matching vir2" + } + }, + "HideDatasetActionun_sequences": { + "output_name": "un_sequences", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "tabularOutput", + "uuid": "379b9ff3-82b2-4bef-8642-7b7b0de22038", + "label": null + }, + { + "output_name": "fastaOutput", + "uuid": "ca0040e2-0505-4223-a642-f80239d3c151", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", + "input_connections": { + "blast": { + "output_name": "output1", + "id": 13 + }, + "sequences": { + "output_name": "transcripts", + "id": 12 + } + }, + "inputs": [ + { + "name": "blast", + "description": "runtime parameter for tool Parse blast output and compile hits" + }, + { + "name": "sequences", + "description": "runtime parameter for tool Parse blast output and compile hits" + } + ], + "position": { + "top": 285, + "left": 2298 + }, + "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": null, + "type": "tool", + "id": 14, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "b4c9c085d709", + "name": "blastparser_and_hits", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Parse blast output and compile hits" + }, + "17": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "errors": null, + "uuid": "81a62b71-206d-4352-a892-cbd02eb44dd4", + "tool_version": "1.4.1", + "outputs": [ + { + "type": "input", + "name": "paired_output" + }, + { + "type": "input", + "name": "list_output" + }, + { + "type": "input", + "name": "out_file1" + }, + { + "type": "_sniff_", + "name": "paired_out_file" + } + ], + "post_job_actions": { + "HideDatasetActionpaired_out_file": { + "output_name": "paired_out_file", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionlist_output": { + "output_name": "list_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionpaired_output": { + "output_name": "paired_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "input_connections": { + "global_condition|inputs": [ + { + "output_name": "output", + "id": 16 + }, + { + "output_name": "output", + "id": 15 + } + ] + }, + "inputs": [ + { + "name": "global_condition", + "description": "runtime parameter for tool Concatenate multiple datasets" + } + ], + "position": { + "top": 447.5, + "left": 2918 + }, + "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "label": "Concatenate contigs files", + "type": "tool", + "id": 17, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "55cf9d9defd1", + "name": "concatenate_multiple_datasets", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Concatenate multiple datasets" + }, + "16": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", + "errors": null, + "uuid": "7353e15c-42b9-4c68-baa4-5cab9aca3538", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Assemble contigs matching cricket paralysis virus" + } + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cherry_pick_fasta/cherry_pick_fasta/1.0.0", + "input_connections": { + "input": { + "output_name": "fastaOutput", + "id": 14 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Pick Fasta sequences" + } + ], + "position": { + "top": 541, + "left": 2644 + }, + "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Cricket_paralysis_virus\\\"\"}", + "label": "Get contigs matching Cricket paralysis virus", + "type": "tool", + "id": 16, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "e3aee4ba49c6", + "name": "cherry_pick_fasta", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Pick Fasta sequences" + }, + "19": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.3.1", + "errors": null, + "uuid": "dfa7c520-7165-4160-bff8-007b7f8ed955", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "tabular", + "name": "output1" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput1": { + "output_name": "output1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Contigs aligned to DCV" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output1", + "uuid": "6ad6e088-d0ea-4d43-a697-27c0fb44b2bb", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.3.1", + "input_connections": { + "query": { + "output_name": "contigsandsinglets", + "id": 18 + }, + "db_opts|histdb": { + "output_name": "outfile", + "id": 6 + } + }, + "inputs": [ + { + "name": "db_opts", + "description": "runtime parameter for tool NCBI BLAST+ tblastx" + }, + { + "name": "query", + "description": "runtime parameter for tool NCBI BLAST+ tblastx" + } + ], + "position": { + "top": 619, + "left": 3514.5 + }, + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": null, \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Align contigs against DCV using tblastx", + "type": "tool", + "id": 19, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ tblastx" + }, + "18": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", + "errors": null, + "uuid": "778af1ac-bb54-4ae0-b2c9-5c7ffcc932c2", + "tool_version": "2.0.0", + "outputs": [ + { + "type": "fasta", + "name": "contigsandsinglets" + }, + { + "type": "txt", + "name": "cap3stdout" + }, + { + "type": "fasta", + "name": "contigs" + }, + { + "type": "txt", + "name": "contigsqual" + }, + { + "type": "txt", + "name": "contigslink" + }, + { + "type": "txt", + "name": "ace" + }, + { + "type": "txt", + "name": "info" + }, + { + "type": "txt", + "name": "singlets" + } + ], + "post_job_actions": { + "HideDatasetActioninfo": { + "output_name": "info", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncontigsqual": { + "output_name": "contigsqual", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActioncontigsandsinglets": { + "output_name": "contigsandsinglets", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "assemblies of Dicistroviridae hits" + } + }, + "HideDatasetActioncontigs": { + "output_name": "contigs", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncap3stdout": { + "output_name": "cap3stdout", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionsinglets": { + "output_name": "singlets", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActioncontigslink": { + "output_name": "contigslink", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionace": { + "output_name": "ace", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [ + { + "output_name": "contigsandsinglets", + "uuid": "3485aa67-6e70-4446-a886-25bb06d98fc7", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", + "input_connections": { + "inputSequences": { + "output_name": "out_file1", + "id": 17 + } + }, + "inputs": [ + { + "name": "inputSequences", + "description": "runtime parameter for tool cap3" + } + ], + "position": { + "top": 328, + "left": 3250.5 + }, + "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", + "label": "CAP3 to re-assemble contigs", + "type": "tool", + "id": 18, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "d76a0d8a9eac", + "name": "cap3", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "cap3" + }, + "20": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", + "errors": null, + "uuid": "dd641374-9364-423e-b49f-c6d112e87aa8", + "tool_version": "1.0.0", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "New AnCV sequences in DCV scaffold" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "137eae2b-cdc9-494e-9b71-a6214ba981ed", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", + "input_connections": { + "guideSequence": { + "output_name": "outfile", + "id": 4 + }, + "blast_tab": { + "output_name": "output1", + "id": 19 + }, + "sequences": { + "output_name": "contigsandsinglets", + "id": 18 + } + }, + "inputs": [ + { + "name": "guideSequence", + "description": "runtime parameter for tool blast_to_scaffold" + }, + { + "name": "blast_tab", + "description": "runtime parameter for tool blast_to_scaffold" + }, + { + "name": "sequences", + "description": "runtime parameter for tool blast_to_scaffold" + } + ], + "position": { + "top": 360, + "left": 3774 + }, + "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "label": "Get final assembly", + "type": "tool", + "id": 20, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "7d96b28eec49", + "name": "blast_to_scaffold", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "blast_to_scaffold" + }, + "1": { + "tool_id": null, + "errors": null, + "uuid": "759418aa-16fd-4b22-9c6a-d513526203a7", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "8504188c-22d9-4645-bd81-96cc125ab1fc", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 609.5, + "left": 913.5 + }, + "tool_state": "{}", + "label": "P. berghei genome", + "type": "data_input", + "id": 1, + "name": "Input dataset" + }, + "0": { + "tool_id": null, + "errors": null, + "uuid": "2db48841-d4b7-44b4-bef4-6bdd06fa4e24", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "024edd74-8ef9-4ecb-9bfc-be6d87d3012c", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 472, + "left": 185 + }, + "tool_state": "{\"collection_type\": \"list\"}", + "label": "Fastq files", + "type": "data_collection_input", + "id": 0, + "name": "Input dataset collection" + }, + "3": { + "tool_id": null, + "errors": null, + "uuid": "1e4e8a20-e5ee-4e0d-ae6a-9a08bea449a1", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "cdfff80b-df8f-4fa6-8829-dace10a9fc41", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 584, + "left": 1801 + }, + "tool_state": "{}", + "label": "Blast Protein database", + "type": "data_input", + "id": 3, + "name": "Input dataset" + }, + "2": { + "tool_id": null, + "errors": null, + "uuid": "44533213-217f-4ddf-8f2e-c6de65c259fc", + "tool_version": null, + "outputs": [], + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "fdc452f9-6764-423a-8f17-4b174b22b030", + "label": null + } + ], + "annotation": "", + "content_id": null, + "input_connections": {}, + "inputs": [], + "position": { + "top": 708.5, + "left": 916.5 + }, + "tool_state": "{}", + "label": "PhiX174", + "type": "data_input", + "id": 2, + "name": "Input dataset" + }, + "5": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "errors": null, + "uuid": "b903129d-dba4-4db9-be57-5d18a58d93ad", + "tool_version": "2.3.0", + "outputs": [ + { + "type": "input", + "name": "output" + } + ], + "post_job_actions": { + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", + "input_connections": { + "input": { + "output_name": "output", + "id": 0 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool Clip adapter" + } + ], + "position": { + "top": 522, + "left": 441 + }, + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"50\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"accept\\\"\"}", + "label": null, + "type": "tool", + "id": 5, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f7947c5a18b8", + "name": "yac_clipper", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Clip adapter" + }, + "4": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", + "errors": null, + "uuid": "b2c1cc64-4e2f-4b9b-b979-5b7d4991cd3a", + "tool_version": "2.3.0", + "outputs": [ + { + "type": "fasta", + "name": "outfile" + }, + { + "type": "txt", + "name": "logfile" + } + ], + "post_job_actions": { + "HideDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionlogfile": { + "output_name": "logfile", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "DCV NC_001834.1 Guide" + } + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", + "input_connections": {}, + "inputs": [], + "position": { + "top": 727, + "left": 2950.5 + }, + "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"NC_001834.1\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", + "label": "Get DCV genome NC_001834.1 sequence", + "type": "tool", + "id": 4, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "c667d0ee39f5", + "name": "fetch_fasta_from_ncbi", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Retrieve FASTA from NCBI" + }, + "7": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "errors": null, + "uuid": "b34e15aa-633d-46bd-96d8-546f0be2a1a1", + "tool_version": "1.4.1", + "outputs": [ + { + "type": "input", + "name": "paired_output" + }, + { + "type": "input", + "name": "list_output" + }, + { + "type": "input", + "name": "out_file1" + }, + { + "type": "_sniff_", + "name": "paired_out_file" + } + ], + "post_job_actions": { + "HideDatasetActionpaired_out_file": { + "output_name": "paired_out_file", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "#{global_condition.inputs} concatenated" + } + }, + "HideDatasetActionpaired_output": { + "output_name": "paired_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionout_file1": { + "output_name": "out_file1", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionlist_output": { + "output_name": "list_output", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", + "input_connections": { + "global_condition|inputs": { + "output_name": "output", + "id": 5 + } + }, + "inputs": [ + { + "name": "global_condition", + "description": "runtime parameter for tool Concatenate multiple datasets" + } + ], + "position": { + "top": 407.5, + "left": 684 + }, + "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", + "label": "Concatenate read files", + "type": "tool", + "id": 7, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "55cf9d9defd1", + "name": "concatenate_multiple_datasets", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "Concatenate multiple datasets" + }, + "6": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", + "errors": null, + "uuid": "c0104040-d2d4-48e7-9a59-c6aa4c9674b5", + "tool_version": "0.3.1", + "outputs": [ + { + "type": "data", + "name": "outfile" + } + ], + "post_job_actions": { + "HideDatasetActionoutfile": { + "output_name": "outfile", + "action_type": "HideDatasetAction", + "action_arguments": {} + } + }, + "workflow_outputs": [], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", + "input_connections": { + "input_file": { + "output_name": "outfile", + "id": 4 + } + }, + "inputs": [ + { + "name": "mask_data_file", + "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" + }, + { + "name": "input_file", + "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" + } + ], + "position": { + "top": 781, + "left": 3222 + }, + "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"DCV NC_001834.1\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", + "label": "Blast databse of DCV", + "type": "tool", + "id": 6, + "tool_shed_repository": { + "owner": "devteam", + "changeset_revision": "e25d3acf6e68", + "name": "ncbi_blast_plus", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "NCBI BLAST+ makeblastdb" + }, + "9": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "errors": null, + "uuid": "51ff0b44-2940-4592-ac62-cc1374d0f17c", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "tabular", + "name": "output" + }, + { + "type": "input", + "name": "aligned" + }, + { + "type": "input", + "name": "unaligned" + } + ], + "post_job_actions": { + "HideDatasetActionaligned": { + "output_name": "aligned", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "HideDatasetActionoutput": { + "output_name": "output", + "action_type": "HideDatasetAction", + "action_arguments": {} + }, + "RenameDatasetActionunaligned": { + "output_name": "unaligned", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Non A. gambiae sequences" + } + } + }, + "workflow_outputs": [ + { + "output_name": "unaligned", + "uuid": "71b068ac-3ff4-4d1e-9646-d44b4acb6235", + "label": null + } + ], + "annotation": "Get non A. gambiae reads", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", + "input_connections": { + "input": { + "output_name": "output", + "id": 8 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sR_bowtie" + } + ], + "position": { + "top": 259, + "left": 1388 + }, + "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"AgamP4\\\"}\", \"method\": \"\\\"k_option\\\"\"}", + "label": "Align to A. gambiae", + "type": "tool", + "id": 9, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "0281bb245635", + "name": "sr_bowtie", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sR_bowtie" + }, + "8": { + "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", + "errors": null, + "uuid": "de629b33-1300-4a78-ad2a-a645996f5aa5", + "tool_version": "2.1.1", + "outputs": [ + { + "type": "fasta", + "name": "output" + } + ], + "post_job_actions": { + "RenameDatasetActionoutput": { + "output_name": "output", + "action_type": "RenameDatasetAction", + "action_arguments": { + "newname": "Initial Clipped sequences" + } + } + }, + "workflow_outputs": [ + { + "output_name": "output", + "uuid": "828446e9-d62e-42e4-ada9-ad6bcb281469", + "label": null + } + ], + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", + "input_connections": { + "input": { + "output_name": "out_file1", + "id": 7 + } + }, + "inputs": [ + { + "name": "input", + "description": "runtime parameter for tool sequence_format_converter" + } + ], + "position": { + "top": 452, + "left": 996.5 + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", + "label": "Collapse reads", + "type": "tool", + "id": 8, + "tool_shed_repository": { + "owner": "artbio", + "changeset_revision": "f1d59113125a", + "name": "sequence_format_converter", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "name": "sequence_format_converter" + } + }, + "annotation": "", + "name": "Metavisitor: Workflow for Use Case 2-1" +}
