Mercurial > repos > artbio > small_read_size_histograms
diff size_histogram.xml @ 0:234b83159ea8 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/small_read_size_histograms commit ab983b2e57321e8913bd4d5f8fc89c3223c69869
author | artbio |
---|---|
date | Tue, 11 Jul 2017 11:44:36 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/size_histogram.xml Tue Jul 11 11:44:36 2017 -0400 @@ -0,0 +1,168 @@ +<tool id="artbio_size_histogram" name="Generate read size histograms" version="1.0.0"> + <description>from alignment files</description> + <requirements> + <requirement type="package" version="1.2.0=py27_0">bowtie</requirement> + <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> + <requirement type="package" version="1.9.3">numpy</requirement> + <requirement type="package" version="1.3.2=r3.3.2_0">r-optparse</requirement> + <requirement type="package" version="0.6_28=r3.3.2_0">r-latticeextra</requirement> + <requirement type="package" version="2.2.1=r3.3.2_0">r-gridextra</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + python '$__tool_directory__'/size_histogram.py + #if $refGenomeSource.genomeSource == "history": + --reference_fasta ## sys.argv[2] + '$refGenomeSource.ownFile' ## index source + #else: + #silent reference= filter( lambda x: str( x[0] ) == str( $refGenomeSource.series[0].input.dbkey ), $__app__.tool_data_tables[ 'bowtie_indexes' ].get_fields() )[0][-1] + --reference_bowtie_index + '$reference' + #end if + --output_size_distribution + '$size_distribution_dataframe' + --minquery + $minquery + --maxquery + $maxquery + --input + #for $i in $refGenomeSource.series + '$i.input' + #end for + --ext + #for $i in $refGenomeSource.series + '$i.input.ext' + #end for + --label + #for $i in $refGenomeSource.series + "$i.input.element_identifier" + #end for + #if $gff: + --gff '$gff' + #end if + #if $global.value == 'yes': + --global_size + #end if + #if $collapsestrands.value == 'yes': + --collapse + #end if + --normalization_factor + #for $i in $refGenomeSource.series + $i.norm + #end for + && + Rscript '$__tool_directory__'/size_histogram.r + --global '$global' + --size_distribution_tab '$size_distribution_dataframe' + --size_distribution_pdf '$size_PDF' + --title '$title' + --ylabel '$ylabel' + --yrange '$yrange' + --rows_per_page '$rows_per_page' + ]]></command> + <inputs> + <conditional name="refGenomeSource"> + <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"> + <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="database not set for this bowtie output. Select the database(=genome used for matching) manually, or select a reference fasta from your history."/> + </param> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + <when value="history"> + <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" /> + <repeat name="series" title="Add alignment files"> + <param name="input" type="data" label="Select multiple alignments to parse" format="tabular,sam,bam"/> + <param name="norm" type="float" value="1" label="Indicate a normalization factor to compare multiple aligments"/> + </repeat> + </when> + </conditional> + <param name="gff" type="data" format="gff,gff3" optional="true" label="Optional: select a GFF to investigate regions of interest" help="GFF must match genome build"/> + <!-- <validator type="dataset_metadata_in_data_table" table_name="bowtie_indexes" metadata_name="dbkey" metadata_column="0" message="GFF database and alignment file databse do not match!"/> --> + <param name="global" type="select" label="Generate size distribution for each item, or generate a global alignment"> + <option value="no">for each item</option> + <option value="yes">global</option> + </param> + <param name="collapsestrands" type="select" label="Whether + and - reads should be collapsed or not"> + <option value="no">Do not collapse</option> + <option value="yes">Collapse + and - reads</option> + </param> + <param name="minquery" type="integer" size="3" value="18" label="Min size of reads to plot" help="'15' = 15 nucleotides"/> + <param name="maxquery" type="integer" size="3" value="28" label="Max size of reads to plot" help="'30' = 30 nucleotides"/> + <param name="title" type="text" size="15" value="Size distribution" label="Main Titles"/> + <param name="xlabel" type="text" size="15" value="Size in nucleotides" label="x axis label"/> + <param name="ylabel" type="text" size="15" value="Number of reads" label="y axis label"/> + <param name="yrange" type="integer" size="3" value="0" label="y axis range for size distributions. 0 means auto-scaling."/> + <param name="rows_per_page" type="text" size="9" value="8" label="How many items to display per page?"> + <validator type="in_range" min="6" max="20" message="Select between 6 and 20 rows, as the readability will suffer otherwise."/> + </param> + </inputs> + + <outputs> + <data format="tabular" name="size_distribution_dataframe" label="Size_distribution_dataframe.tab"/> + <data format="pdf" name="size_PDF" label="Size_distribution.pdf"/> + </outputs> + +<help> + +**What it does** + +Takes one or more alignment files (BAM, SAM or tabular bowtie output) as input and produces a histogram of read sizes, +where by default for each "chromosome" a histogram of read sizes is drawn. +Reads that map in sense are on the top (red), reads that map antisense are on the bottom (blue). + + +.. class:: warningmark + +'''TIP''' The input data can be produced using the sRbowtie tool. + +---- + +'''Example''' + +Query sequence:: +For a SAM file as the following: + + 5 16 2L_79 24393 255 17M * 0 0 CCTTCATCTTTTTTTTT IIIIIIIIIIIIIIIII XA:i:0 MD:Z:17 NM:i:0 + + 11 0 2R_1 12675 255 21M * 0 0 AAAAAAAACGCGTCCTTGTGC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 + + 2 16 2L_5 669 255 23M * 0 0 TGTTGCTGCATTTCTTTTTTTTT IIIIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:23 NM:i:0 + +produce a plot like this: + +---- + +.. image:: static/images/size_histogram.png + :height: 800 + :width: 500 + +</help> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param name="ownFile" value="transposons.fasta" ftype="fasta" /> + <param name="series_0|input" value="sample1.srbowtie_out" ftype="tabular"/> + <param name="series_0|norm" value="1" /> + <param name="series_1|input" value="sample2.srbowtie_out" ftype="tabular"/> + <param name="series_1|norm" value="1" /> + <param name="series_2|input" value="sample3.srbowtie_out" ftype="tabular"/> + <param name="series_2|norm" value="1" /> + <param name="global" value="no" /> + <param name="collapsestrands" value="no" /> + <param name="minquery" value="18"/> + <param name="maxquery" value="30"/> + <param name="title" value="Size distribution"/> + <param name="xlabel" value="Size in nucleotides"/> + <param name="ylabel" value="Number of reads"/> + <param name="rows_per_page" value="10"/> + <output name="size_distribution_dataframe" ftype="tabular" file="Size_distribution_dataframe.tab" /> + <output name="size_PDF" ftype="pdf" file="Size_distribution.pdf" /> + </test> + </tests> +</tool> +