Mercurial > repos > artbio > small_rna_signatures
comparison overlapping_reads.xml @ 3:4d9682bd3a6b draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/small_rna_signatures commit 96ed5824190aff281cc3aa47dc60fc66aac41db3
author | artbio |
---|---|
date | Sat, 02 Sep 2017 06:35:15 -0400 |
parents | 320e06bf99b9 |
children | 20d28cfdeefe |
comparison
equal
deleted
inserted
replaced
2:320e06bf99b9 | 3:4d9682bd3a6b |
---|---|
1 <tool id="overlapping_reads" name="Get overlapping reads" version="0.9.1"> | 1 <tool id="overlapping_reads" name="Get overlapping reads" version="0.9.2"> |
2 <description /> | 2 <description /> |
3 <requirements> | 3 <requirements> |
4 <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> | 4 <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> |
5 </requirements> | 5 </requirements> |
6 <stdio> | 6 <stdio> |
36 <param name="mintarget" value="23" /> | 36 <param name="mintarget" value="23" /> |
37 <param name="maxtarget" value="29" /> | 37 <param name="maxtarget" value="29" /> |
38 <param name="overlap" value="10" /> | 38 <param name="overlap" value="10" /> |
39 <output file="paired.fa" ftype="fasta" name="output" /> | 39 <output file="paired.fa" ftype="fasta" name="output" /> |
40 </test> | 40 </test> |
41 <test> | |
42 <param ftype="bam" name="input" value="sr_bowtie.bam" /> | |
43 <param name="minquery" value="20" /> | |
44 <param name="maxquery" value="22" /> | |
45 <param name="mintarget" value="23" /> | |
46 <param name="maxtarget" value="29" /> | |
47 <param name="overlap" value="10" /> | |
48 <output file="paired_2.fa" ftype="fasta" name="output" /> | |
49 </test> | |
41 </tests> | 50 </tests> |
42 <help> | 51 <help> |
43 | 52 |
44 **What it does** | 53 **What it does** |
45 | 54 |
50 | 59 |
51 .. _Antoniewski (2014): https://link.springer.com/protocol/10.1007%2F978-1-4939-0931-5_12 | 60 .. _Antoniewski (2014): https://link.springer.com/protocol/10.1007%2F978-1-4939-0931-5_12 |
52 | 61 |
53 **Input** | 62 **Input** |
54 | 63 |
55 A **sorted** BAM alignment file. | 64 *A **sorted** BAM alignment file.* |
65 | |
66 *Query and target sizes:* | |
67 | |
68 The algorithm search for each *query* reads (of specified size) in the bam alignment if | |
69 there are *target* reads (of specified size) that align on the opposite strand with a 10 nt | |
70 overlap. | |
71 | |
72 Searching query reads of 20-22 nt that overlap by 10 nt with target | |
73 reads of 23-29 nt is different from searching query reads of 23-29 nt that overlap by 10 nt | |
74 with target reads of 20-22 nt. i.e, searching for siRNAs that pair with piRNAs is distinct | |
75 from searching for siRNAs that pairs with piRNAs, although of course the number of possibly | |
76 formed piRNA/siRNA pairs is the same as the number of possibly formed siRNA/piRNA pairs. | |
77 | |
78 *Overlap* | |
79 The number of nucleotides by which the pairs of sequences will overlap | |
80 | |
81 | |
56 | 82 |
57 **Outputs** | 83 **Outputs** |
58 | 84 |
59 a fasta file of pairable reads such as : | 85 a fasta file of pairable reads such as : |
60 | 86 |
61 >FBgn0000004_17.6|5839|R|26 | 87 >FBgn0000004_17.6|5855|F|23|n=1 |
88 | |
89 TTGACGAAAATGATCGAGTGGAT | |
90 | |
91 >FBgn0000004_17.6|5839|R|26|n=1 | |
62 | 92 |
63 TTTTCGTCAATTGTGCCAAATAGGTA | 93 TTTTCGTCAATTGTGCCAAATAGGTA |
64 | 94 |
65 >FBgn0000004_17.6|5855|F|23 | 95 where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position, |
96 R stand for reverse strand (F forward strand), 26 stands for the size of the sequence and | |
97 n=1 stands for the number of reads of the sequence in the dataset. | |
66 | 98 |
67 TTGACGAAAATGATCGAGTGGAT | 99 the second sequence in this example corresponds to 1 read that overlap by 10 nt with |
68 | 100 1 read of the first sequence. |
69 where FBgn0000004_17.6 stands for the chromosome, 5839 stands for the 1-based read position, | |
70 R stand for reverse strand (F forward strand) and 26 stands for the size of the read. | |
71 | |
72 the second sequence in this example is a read that overlap by 10 nt with the first read. | |
73 | 101 |
74 </help> | 102 </help> |
75 <citations> | 103 <citations> |
76 <citation type="doi">10.1007/978-1-4939-0931-5_12</citation> | 104 <citation type="doi">10.1007/978-1-4939-0931-5_12</citation> |
77 </citations> | 105 </citations> |