--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/yac.xml	Wed Jul 26 13:35:39 2017 -0400
@@ -0,0 +1,95 @@
+<tool id="yac" name="Clip adapter" version="2.0.0">
+    <description />
+    <command interpreter="python">yac.py --input $input
+                                       --output $output
+                                       --output_format "$out_format"
+                                       --adapter_to_clip $clip_source.clip_sequence
+                                       --min $min
+                                       --max $max
+                                       --Nmode $Nmode
+  </command>
+    <inputs>
+        <param format="fastq" label="Source file" name="input" type="data" />
+        <param label="min size" name="min" size="4" type="integer" value="15" />
+        <param label="max size" name="max" size="4" type="integer" value="36" />
+        <param label="Select output format" name="out_format" type="select">
+            <option selected="true" value="fasta">Fasta format</option>
+            <option value="fastq">Fastq format</option>
+        </param>
+        <param label="Accept reads containing N?" name="Nmode" type="select">
+            <option selected="True" value="accept">accept</option>
+            <option value="reject">reject</option>
+        </param>
+        <conditional name="clip_source">
+            <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select">
+                <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option>
+                <option value="user">Use custom sequence</option>
+            </param>
+            <when value="prebuilt">
+                <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select">
+                    <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
+                    <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
+                    <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
+                    <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
+                </param>
+            </when>
+            <when value="user">
+                <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="fasta" metadata_source="input" name="output" label="Clipping of ${input.name}">
+          <change_format>
+              <when input="out_format" value="fastq" format="fastq" />
+          </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <output file="yac.out" name="output" />
+        </test>
+        <test>
+            <param ftype="fastqsanger" name="input" value="yac.fastq" />
+            <param name="min" value="18" />
+            <param name="max" value="29" />
+            <param name="clip_source_list" value="prebuilt" />
+            <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
+            <param name="Nmode" value="accept" />
+            <param name="out_format" value="fastq" />
+            <output file="yac_fastq.out" name="output" />
+        </test>
+    </tests>
+    <help>
+
+**What it does**
+
++ Clips adapter sequences
++ Renumbers sequence headers
++ Filters sequences on their size
++ Filters sequences containing unknown nucleotides (optional)
+
+-------
+
+**Inputs**
+
+1. A fastq file of reads to be clipped
+2. Select the size of the reads to be kept
+3. Select an output format when input is a fastq file (this may be fastq or fastq)
+4. Select whether you wish or do not wish to keep clipped sequences with unknown nucleotides (N)
+5. Select a pre-built adapter sequence or enter your own sequence (at least 7 nucleotides long)
+
+-------
+
+**Output**
+
+A fastq or fasta file containing clipped sequences satisfying the selected criteria.
+
+  </help>
+</tool>