Mercurial > repos > bgruening > augustus
comparison augustus.xml @ 4:4de31938431b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/augustus commit 2896dcfd180800d00ea413a59264ef8b11788b8e
author | iuc |
---|---|
date | Fri, 20 Oct 2017 03:48:57 -0400 |
parents | f5075dee9d6b |
children | b3f5d0879dab |
comparison
equal
deleted
inserted
replaced
3:f5075dee9d6b | 4:4de31938431b |
---|---|
1 <tool id="augustus" name="Augustus" version="3.1.0"> | 1 <tool id="augustus" name="Augustus" profile="16.04" version="@VERSION@"> |
2 <description>gene prediction for eukaryotic genomes</description> | 2 <description>gene prediction for prokaryotic and eukaryotic genomes</description> |
3 <parallelism method="multi" split_inputs="input_genome" split_mode="to_size" split_size="10" merge_outputs="output,protein_output,codingseq_output"></parallelism> | 3 <macros> |
4 <requirements> | 4 <import>macros.xml</import> |
5 <requirement type="package" version="3.1">augustus</requirement> | 5 </macros> |
6 </requirements> | 6 <expand macro="requirements"/> |
7 <stdio> | 7 <command detect_errors="aggressive"> |
8 <exit_code range="1:" /> | |
9 <exit_code range=":-1" /> | |
10 <regex match="Error:" /> | |
11 <regex match="Exception:" /> | |
12 </stdio> | |
13 <command> | |
14 <![CDATA[ | 8 <![CDATA[ |
9 #if $model.augustus_mode == 'history' | |
10 | |
11 ## Using an augustus model from history, we need to unzip it and let augustus find it | |
12 | |
13 cp -r "\$AUGUSTUS_CONFIG_PATH/" augustus_dir/ && | |
14 | |
15 mkdir -p 'augustus_dir/species/' && | |
16 | |
17 tar -C 'augustus_dir/species/' -xzvf '${model.custom_model}' > /dev/null && | |
18 | |
19 export AUGUSTUS_CONFIG_PATH=`pwd`/augustus_dir/ && | |
20 #end if | |
21 | |
15 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external | 22 ## Augustus writes the protein and coding sequences as comment into the gff/gtf file an external |
16 ## script is used to extract the sequences into additional files | 23 ## script is used to extract the sequences into additional files |
17 | 24 |
18 augustus | 25 augustus |
19 --strand=$strand | 26 --strand=$strand |
59 | 66 |
60 $singlestrand | 67 $singlestrand |
61 $input_genome | 68 $input_genome |
62 $utr | 69 $utr |
63 --genemodel=$genemodel | 70 --genemodel=$genemodel |
64 --species=$organism | 71 |
65 | 72 |
66 | tee $output | 73 #if $model.augustus_mode == 'history' |
74 --species=local | |
75 #else | |
76 --species=$model.organism | |
77 #end if | |
78 | |
79 | tee '$output' | |
67 #if 'protein' in str($outputs).split(',') or 'codingseq' in str($outputs).split(','): | 80 #if 'protein' in str($outputs).split(',') or 'codingseq' in str($outputs).split(','): |
68 | python $__tool_directory__/extract_features.py | 81 | python $__tool_directory__/extract_features.py |
69 #if 'protein' in str($outputs).split(','): | 82 #if 'protein' in str($outputs).split(','): |
70 --protein $protein_output | 83 --protein $protein_output |
71 #end if | 84 #end if |
76 ]]> | 89 ]]> |
77 </command> | 90 </command> |
78 <inputs> | 91 <inputs> |
79 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> | 92 <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> |
80 <param name="noInFrameStop" argument="--noInFrameStop" type="boolean" | 93 <param name="noInFrameStop" argument="--noInFrameStop" type="boolean" |
81 label="Don't report transcripts with in-frame stop codons (--noInFrameStop)" | 94 label="Don't report transcripts with in-frame stop codons" |
82 truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" | 95 truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" |
83 help="Otherwise, intron-spanning stop codons could occur. (--noInFrameStop)" /> | 96 help="Otherwise, intron-spanning stop codons could occur." /> |
84 <param name="singlestrand" type="boolean" argument="--singlestrand" | 97 <param name="singlestrand" type="boolean" argument="--singlestrand" |
85 label="Predict genes independently on each strand" | 98 label="Predict genes independently on each strand" |
86 help="This allows overlapping genes on opposite strands. (--singlestrand)" | 99 help="This allows overlapping genes on opposite strands." |
87 truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> | 100 truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> |
88 | 101 |
89 <param name="utr" type="boolean" argument="--UTR" | 102 <param name="utr" type="boolean" argument="--UTR" |
90 label="Predict the untranslated regions in addition to the coding sequence" | 103 label="Predict the untranslated regions in addition to the coding sequence" |
91 truevalue="--UTR=on" falsevalue="--UTR=off" checked="false" | 104 truevalue="--UTR=on" falsevalue="--UTR=off" checked="false" |
92 help="This currently works only for human, galdieria, toxoplasma and caenorhabditis. (--UTR)" /> | 105 help="This currently works only for human, galdieria, toxoplasma and caenorhabditis." /> |
93 | 106 |
94 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> | 107 |
95 <option value="human">Homo sapiens</option> | 108 <conditional name="model"> |
96 <option value="fly">Drosophila melanogaster</option> | 109 <param name="augustus_mode" type="select" label="Trainingset"> |
97 <option value="arabidopsis">Arabidopsis thaliana</option> | 110 <option value="builtin">Run Augustus with a predefined trainingset</option> |
98 <option value="brugia ">Brugia malayi</option> | 111 <option value="history">Run Augustus with a custom trainingset</option> |
99 <option value="aedes">Aedes aegypti</option> | 112 </param> |
100 <option value="tribolium2012">Tribolium castaneum</option> | 113 <when value="history"> |
101 <option value="schistosoma">Schistosoma mansoni</option> | 114 <param name="custom_model" type="data" format="augustus" label="Augustus model" help="Archive created with the 'Train Augustus' tool"/> |
102 <option value="tetrahymena">Tetrahymena thermophila</option> | 115 </when> |
103 <option value="galdieria">Galdieria sulphuraria</option> | 116 <when value="builtin"> |
104 <option value="maize">Zea mays</option> | 117 <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> |
105 <option value="toxoplasma">Toxoplasma gondii</option> | 118 <!-- If you update this list, please also update it in maker and busco tools (../maker/maker.xml and ../busco/busco.xml) --> |
106 <option value="caenorhabditis ">Caenorhabditis elegans</option> | 119 <option value="human">Homo sapiens</option> |
107 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> | 120 <option value="fly">Drosophila melanogaster</option> |
108 <option value="aspergillus_nidulans ">Aspergillus nidulans</option> | 121 <option value="arabidopsis">Arabidopsis thaliana</option> |
109 <option value="aspergillus_oryzae ">Aspergillus oryzae</option> | 122 <option value="brugia ">Brugia malayi</option> |
110 <option value="aspergillus_terreus">Aspergillus terreus</option> | 123 <option value="aedes">Aedes aegypti</option> |
111 <option value="botrytis_cinerea ">Botrytis cinerea</option> | 124 <option value="tribolium2012">Tribolium castaneum</option> |
112 <option value="candida_albicans ">Candida albicans</option> | 125 <option value="schistosoma">Schistosoma mansoni</option> |
113 <option value="candida_guilliermondii ">Candida guilliermondii</option> | 126 <option value="tetrahymena">Tetrahymena thermophila</option> |
114 <option value="candida_tropicalis ">Candida tropicalis</option> | 127 <option value="galdieria">Galdieria sulphuraria</option> |
115 <option value="chaetomium_globosum">Chaetomium globosum</option> | 128 <option value="maize">Zea mays</option> |
116 <option value="coccidioides_immitis">Coccidioides immitis</option> | 129 <option value="toxoplasma">Toxoplasma gondii</option> |
117 <option value="coprinus">Coprinus cinereus</option> | 130 <option value="caenorhabditis ">Caenorhabditis elegans</option> |
118 <option value="coprinus_cinereus">Coprinus cinereus</option> | 131 <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> |
119 <option value="cryptococcus_neoformans_gattii">Cryptococcus neoformans gattii</option> | 132 <option value="aspergillus_nidulans ">Aspergillus nidulans</option> |
120 <option value="cryptococcus_neoformans_neoformans_B">Cryptococcus neoformans neoformans</option> | 133 <option value="aspergillus_oryzae ">Aspergillus oryzae</option> |
121 <option value="cryptococcus_neoformans_neoformans_JEC21">Cryptococcus neoformans neoformans</option> | 134 <option value="aspergillus_terreus">Aspergillus terreus</option> |
122 <option value="cryptococcus">Cryptococcus neoformans</option> | 135 <option value="botrytis_cinerea ">Botrytis cinerea</option> |
123 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> | 136 <option value="candida_albicans ">Candida albicans</option> |
124 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> | 137 <option value="candida_guilliermondii ">Candida guilliermondii</option> |
125 <option value="eremothecium_gossypii">Eremothecium gossypii</option> | 138 <option value="candida_tropicalis ">Candida tropicalis</option> |
126 <option value="fusarium_graminearum ">Fusarium graminearum</option> | 139 <option value="chaetomium_globosum">Chaetomium globosum</option> |
127 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> | 140 <option value="coccidioides_immitis">Coccidioides immitis</option> |
128 <option value="histoplasma">Histoplasma capsulatum</option> | 141 <option value="coprinus">Coprinus cinereus</option> |
129 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> | 142 <option value="coprinus_cinereus">Coprinus cinereus</option> |
130 <option value="laccaria_bicolor ">Laccaria bicolor</option> | 143 <option value="cryptococcus_neoformans_gattii">Cryptococcus neoformans gattii</option> |
131 <option value="lamprey">Petromyzon marinus</option> | 144 <option value="cryptococcus_neoformans_neoformans_B">Cryptococcus neoformans neoformans</option> |
132 <option value="leishmania_tarentolae">Leishmania tarentolae</option> | 145 <option value="cryptococcus_neoformans_neoformans_JEC21">Cryptococcus neoformans neoformans</option> |
133 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> | 146 <option value="cryptococcus">Cryptococcus neoformans</option> |
134 <option value="magnaporthe_grisea ">Magnaporthe grisea</option> | 147 <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> |
135 <option value="neurospora_crassa">Neurospora crassa</option> | 148 <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> |
136 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> | 149 <option value="eremothecium_gossypii">Eremothecium gossypii</option> |
137 <option value="pichia_stipitis">Pichia stipitis</option> | 150 <option value="fusarium_graminearum ">Fusarium graminearum</option> |
138 <option value="rhizopus_oryzae">Rhizopus oryzae</option> | 151 <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> |
139 <option value="saccharomyces_cerevisiae_S288C">Saccharomyces cerevisiae</option> | 152 <option value="histoplasma">Histoplasma capsulatum</option> |
140 <option value="saccharomyces_cerevisiae_rm11-1a_1">Saccharomyces cerevisiae</option> | 153 <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> |
141 <option value="saccharomyces">Saccharomyces cerevisiae</option> | 154 <option value="laccaria_bicolor ">Laccaria bicolor</option> |
142 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> | 155 <option value="lamprey">Petromyzon marinus</option> |
143 <option value="trichinella">Trichinella spiralis</option> | 156 <option value="leishmania_tarentolae">Leishmania tarentolae</option> |
144 <option value="ustilago_maydis">Ustilago maydis</option> | 157 <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> |
145 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> | 158 <option value="magnaporthe_grisea ">Magnaporthe grisea</option> |
146 <option value="nasonia">Nasonia vitripennis</option> | 159 <option value="neurospora_crassa">Neurospora crassa</option> |
147 <option value="tomato">Solanum lycopersicum</option> | 160 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> |
148 <option value="chlamydomonas">Chlamydomonas reinhardtii</option> | 161 <option value="pichia_stipitis">Pichia stipitis</option> |
149 <option value="amphimedon">Amphimedon queenslandica</option> | 162 <option value="rhizopus_oryzae">Rhizopus oryzae</option> |
150 <option value="pneumocystis">Pneumocystis jirovecii</option> | 163 <option value="saccharomyces_cerevisiae_S288C">Saccharomyces cerevisiae</option> |
151 <option value="chicken">Gallus gallus domesticus (chicken)</option> | 164 <option value="saccharomyces_cerevisiae_rm11-1a_1">Saccharomyces cerevisiae</option> |
152 <option value="cacao">Theobroma cacao (cacao)</option> | 165 <option value="saccharomyces">Saccharomyces cerevisiae</option> |
153 <option value="heliconius_melpomene1">Heliconius melpomene</option> | 166 <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> |
154 <option value="xenoturbella">Xenoturbella</option> | 167 <option value="trichinella">Trichinella spiralis</option> |
155 <option value="E_coli_K12">E coli K12</option> | 168 <option value="ustilago_maydis">Ustilago maydis</option> |
156 <option value="c_elegans_trsk">c elegans trsk</option> | 169 <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> |
157 <option value="camponotus_floridanus">Camponotus floridanus</option> | 170 <option value="nasonia">Nasonia vitripennis</option> |
158 <option value="coyote_tobacco">Coyote tobacco</option> | 171 <option value="tomato">Solanum lycopersicum</option> |
159 <option value="s_aureus">Staphylococcus aureus</option> | 172 <option value="chlamydomonas">Chlamydomonas reinhardtii</option> |
160 <option value="thermoanaerobacter_tengcongensis">Thermoanaerobacter tengcongensis</option> | 173 <option value="amphimedon">Amphimedon queenslandica</option> |
161 <option value="wheat">wheat</option> | 174 <option value="pneumocystis">Pneumocystis jirovecii</option> |
162 <option value="zebrafish">Danio rerio</option> | 175 <option value="chicken">Gallus gallus domesticus (chicken)</option> |
163 <option value="anidulans">Aspergillus nidulans</option> | 176 <option value="cacao">Theobroma cacao (cacao)</option> |
164 <option value="bombus_impatiens1">Bombus impatiens1</option> | 177 <option value="heliconius_melpomene1">Heliconius melpomene</option> |
165 <option value="bombus_terrestris2">Bombus terrestris2</option> | 178 <option value="xenoturbella">Xenoturbella</option> |
166 <option value="botrytis_cinerea">Botrytis cinerea</option> | 179 <option value="E_coli_K12">E coli K12</option> |
167 <option value="brugia_malayi">Brugia malayi</option> | 180 <option value="c_elegans_trsk">c elegans trsk</option> |
168 <option value="conidiobolus_coronatus">Conidiobolus coronatus</option> | 181 <option value="camponotus_floridanus">Camponotus floridanus</option> |
169 <option value="cryptococcus_neoformans">Cryptococcus neoformans</option> | 182 <option value="coyote_tobacco">Coyote tobacco</option> |
170 <option value="culex_pipiens">Culex pipiens</option> | 183 <option value="s_aureus">Staphylococcus aureus</option> |
171 <option value="elephant_shark">Callorhinchus milii</option> | 184 <option value="thermoanaerobacter_tengcongensis">Thermoanaerobacter tengcongensis</option> |
172 <option value="honeybee1">Apis mellifera</option> | 185 <option value="wheat">wheat</option> |
173 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> | 186 <option value="zebrafish">Danio rerio</option> |
174 <option value="pea_aphid">Acyrthosiphon pisum</option> | 187 <option value="anidulans">Aspergillus nidulans</option> |
175 <option value="rhodnius_prolixus">Rhodnius prolixus</option> | 188 <option value="bombus_impatiens1">Bombus impatiens1</option> |
176 <option value="ustilago_maydis">Ustilago maydis</option> | 189 <option value="bombus_terrestris2">Bombus terrestris2</option> |
177 <option value="verticillium_albo_atrum1">Verticillium albo atrum1</option> | 190 <option value="botrytis_cinerea">Botrytis cinerea</option> |
178 <option value="verticillium_longisporum1">Verticillium longisporum1</option> | 191 <option value="brugia_malayi">Brugia malayi</option> |
179 <option value="Xipophorus_maculatus">Xipophorus_maculatus</option> | 192 <option value="conidiobolus_coronatus">Conidiobolus coronatus</option> |
180 <option value="adorsata">adorsata</option> | 193 <option value="cryptococcus_neoformans">Cryptococcus neoformans</option> |
181 <option value="ancylostoma_ceylanicum">ancylostoma_ceylanicum</option> | 194 <option value="culex_pipiens">Culex pipiens</option> |
182 <option value="maker2_athal1">maker2_athal1</option> | 195 <option value="elephant_shark">Callorhinchus milii</option> |
183 <option value="maker2_c_elegans1">maker2_c_elegans1</option> | 196 <option value="honeybee1">Apis mellifera</option> |
184 <option value="maker2_dmel1">maker2_dmel1</option> | 197 <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> |
185 <option value="maker2_spomb1">maker2_spomb1</option> | 198 <option value="pea_aphid">Acyrthosiphon pisum</option> |
186 <option value="parasteatoda">parasteatoda</option> | 199 <option value="rhodnius_prolixus">Rhodnius prolixus</option> |
187 <option value="rice">rice</option> | 200 <option value="ustilago_maydis">Ustilago maydis</option> |
188 <option value="schistosoma2">schistosoma2</option> | 201 <option value="verticillium_albo_atrum1">Verticillium albo atrum1</option> |
189 <option value="sulfolobus_solfataricus">sulfolobus_solfataricus</option> | 202 <option value="verticillium_longisporum1">Verticillium longisporum1</option> |
190 </param> | 203 <option value="Xipophorus_maculatus">Xipophorus_maculatus</option> |
204 <option value="adorsata">adorsata</option> | |
205 <option value="ancylostoma_ceylanicum">ancylostoma_ceylanicum</option> | |
206 <option value="maker2_athal1">maker2_athal1</option> | |
207 <option value="maker2_c_elegans1">maker2_c_elegans1</option> | |
208 <option value="maker2_dmel1">maker2_dmel1</option> | |
209 <option value="maker2_spomb1">maker2_spomb1</option> | |
210 <option value="parasteatoda">parasteatoda</option> | |
211 <option value="rice">rice</option> | |
212 <option value="schistosoma2">schistosoma2</option> | |
213 <option value="sulfolobus_solfataricus">sulfolobus_solfataricus</option> | |
214 </param> | |
215 </when> | |
216 </conditional> | |
191 | 217 |
192 <param name="strand" type="select" argument="--strand" | 218 <param name="strand" type="select" argument="--strand" |
193 label="Predict genes on specific strands" help="(--strand)"> | 219 label="Predict genes on specific strands"> |
194 <option value="both">both</option> | 220 <option value="both">both</option> |
195 <option value="forward">forward</option> | 221 <option value="forward">forward</option> |
196 <option value="backward">backward</option> | 222 <option value="backward">backward</option> |
197 </param> | 223 </param> |
198 | 224 |
199 <param name="genemodel" label="Gene Model" type="select" | 225 <param name="genemodel" label="Gene Model" type="select" |
200 help="Gene Model to predict, for more information please refere to the help. (--genemodel)"> | 226 help="Gene Model to predict, for more information please refere to the help."> |
201 <option value="complete">complete</option> | 227 <option value="complete">complete</option> |
202 <option value="partial">partial</option> | 228 <option value="partial">partial</option> |
203 <option value="intronless">intronless</option> | 229 <option value="intronless">intronless</option> |
204 <option value="atleastone">atleastone</option> | 230 <option value="atleastone">atleastone</option> |
205 <option value="exactlyone">exactlyone</option> | 231 <option value="exactlyone">exactlyone</option> |
206 </param> | 232 </param> |
207 | 233 |
208 <param name="gff" type="boolean" label="GFF formated output" | 234 <param name="gff" type="boolean" label="GFF formated output" |
209 help="Standard output is GTF. (--gff3)" | 235 help="Standard output is GTF." |
210 truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> | 236 truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> |
211 | 237 |
212 <param name="outputs" type="select" display="checkboxes" multiple="True" label="Output options"> | 238 <param name="outputs" type="select" display="checkboxes" multiple="True" label="Output options"> |
213 <option value="protein" selected="True">predicted protein sequences (--protein)</option> | 239 <option value="protein" selected="True">predicted protein sequences (--protein)</option> |
214 <option value="codingseq" selected="True">coding sequence as comment in the output file (--codingseq)</option> | 240 <option value="codingseq" selected="True">coding sequence as comment in the output file (--codingseq)</option> |
215 <option value="introns">predicted intron sequences (--introns)</option> | 241 <option value="introns">predicted intron sequences (--introns)</option> |
216 <option value="start">predicted start codons (--start)</option> | 242 <option value="start">predicted start codons (--start)</option> |
217 <option value="stop">predicted stop codons (--stop)</option> | 243 <option value="stop">predicted stop codons (--stop)</option> |
218 <option value="cds" selected="true">CDS region (--cds)</option> | 244 <option value="cds" selected="true">CDS region (--cds)</option> |
219 | |
220 <validator type="no_options" message="Please select at least one output file." /> | |
221 </param> | 245 </param> |
222 | |
223 </inputs> | 246 </inputs> |
224 <outputs> | 247 <outputs> |
225 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF"> | 248 <data format="gtf" name="output" label="${tool.name} on ${on_string}: GTF/GFF"> |
226 <change_format> | 249 <change_format> |
227 <when input="gff" value="--gff3=on" format="gff3" /> | 250 <when input="gff" value="--gff3=on" format="gff3" /> |
260 <help> | 283 <help> |
261 <![CDATA[ | 284 <![CDATA[ |
262 | 285 |
263 **What it does** | 286 **What it does** |
264 | 287 |
265 AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller. | 288 AUGUSTUS is a gene prediction program for prokaryotes and eukaryotes written by Mario Stanke and Oliver Keller. |
266 It can be used as an ab initio program, which means it bases its prediction purely on the | 289 It can be used as an ab initio program, which means it bases its prediction purely on the |
267 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources | 290 sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources |
268 such as EST, MS/MS, protein alignments and synthenic genomic alignments. | 291 such as EST, MS/MS, protein alignments and synthenic genomic alignments. |
269 | 292 |
270 ----- | 293 |
294 **Input** | |
295 | |
296 Input data for the gene prediction tool Augustus is a FASTA file with a genomic nucleotide sequence. | |
297 | |
298 | |
299 **Output** | |
300 | |
301 Augustus produces three output files: a FASTA file with predicted coding sequences, a FASTA file with predicted protein sequences and a gtf/GFF output file if selected. | |
302 | |
271 | 303 |
272 **Parameters** | 304 **Parameters** |
273 | 305 |
274 Gene Model:: | 306 Gene Model: |
275 | 307 |
276 partial : allow prediction of incomplete genes at the sequence boundaries (default) | 308 partial: allow prediction of incomplete genes at the sequence boundaries (default) |
277 intronless : only predict single-exon genes like in prokaryotes and some eukaryotes | 309 intronless: only predict single-exon genes like in prokaryotes and some eukaryotes |
278 complete : only predict complete genes | 310 complete: only predict complete genes |
279 atleastone : predict at least one complete gene | 311 atleastone: predict at least one complete gene |
280 exactlyone : predict exactly one complete gene | 312 exactlyone: predict exactly one complete gene |
281 | 313 |
282 | 314 |
283 | 315 |
284 **Example** | 316 **Example** |
285 | 317 |
286 Suppose you have the following DNA formatted sequences:: | 318 Suppose you have the following DNA FASTA sequence: |
287 | 319 |
288 >Seq1 | 320 >Seq1 |
289 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg | 321 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg |
290 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag | 322 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag |
291 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc | 323 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc |
292 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc | 324 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc |
293 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg | 325 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg |
294 | 326 |
295 Running this tool will produce this:: | 327 |
328 Running this tool will produce this: | |
296 | 329 |
297 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- | 330 # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- |
298 # | 331 # |
299 # Constraints/Hints: | 332 # Constraints/Hints: |
300 # (none) | 333 # (none) |
317 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; | 350 scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; |
318 | 351 |
319 | 352 |
320 ]]> | 353 ]]> |
321 </help> | 354 </help> |
322 <citations> | 355 <expand macro="citations"/> |
323 <citation type="doi">10.1093/bioinformatics/btg1080</citation> | |
324 </citations> | |
325 </tool> | 356 </tool> |