Mercurial > repos > bgruening > bismark

comparison test-data/summary.txt @ 13:f211753166bd draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b9780e368b2e46dc541a846519ccc9593226ee0d
author bgruening
date Tue, 30 Jul 2019 06:30:36 -0400
parents 9bfe38410155
children 0b656f8c5637
comparison
equal deleted inserted replaced
12:78c791a11b4c 13:f211753166bd
1 Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation 1 Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
2 Generating index with: 'bismark_genome_preparation --bowtie2 /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf' 2 Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpProAS5'
3 Writing bisulfite genomes out into a single MFA (multi FastA) file 3 Writing bisulfite genomes out into a single MFA (multi FastA) file
4 4
5 Bisulfite Genome Indexer version v0.20.0 (last modified 26 April 2018) 5 Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
6 6
7 Step I - Prepare genome folders - completed 7 Step I - Prepare genome folders - completed
8 8
9 9
10 10
77 Entering Ebwt loop 77 Entering Ebwt loop
78 Getting block 1 of 1 78 Getting block 1 of 1
79 No samples; assembling all-inclusive block 79 No samples; assembling all-inclusive block
80 Sorting block of length 756159 for bucket 1 80 Sorting block of length 756159 for bucket 1
81 (Using difference cover) 81 (Using difference cover)
82 Sorting block time: 00:00:01 82 Sorting block time: 00:00:00
83 Returning block of 756160 for bucket 1 83 Returning block of 756160 for bucket 1
84 Exited Ebwt loop 84 Exited Ebwt loop
85 fchr[A]: 0 85 fchr[A]: 0
86 fchr[C]: 235897 86 fchr[C]: 235897
87 fchr[G]: 235897 87 fchr[G]: 235897
116 numLines: 3939 116 numLines: 3939
117 ebwtTotLen: 252096 117 ebwtTotLen: 252096
118 ebwtTotSz: 252096 118 ebwtTotSz: 252096
119 color: 0 119 color: 0
120 reverse: 0 120 reverse: 0
121 Total time for call to driver() for forward index: 00:00:01 121 Total time for call to driver() for forward index: 00:00:00
122 Reading reference sizes 122 Reading reference sizes
123 Time reading reference sizes: 00:00:00 123 Time reading reference sizes: 00:00:00
124 Calculating joined length 124 Calculating joined length
125 Writing header 125 Writing header
126 Reserving space for joined string 126 Reserving space for joined string
160 Entering Ebwt loop 160 Entering Ebwt loop
161 Getting block 1 of 1 161 Getting block 1 of 1
162 No samples; assembling all-inclusive block 162 No samples; assembling all-inclusive block
163 Sorting block of length 756159 for bucket 1 163 Sorting block of length 756159 for bucket 1
164 (Using difference cover) 164 (Using difference cover)
165 Sorting block time: 00:00:00 165 Sorting block time: 00:00:01
166 Returning block of 756160 for bucket 1 166 Returning block of 756160 for bucket 1
167 Exited Ebwt loop 167 Exited Ebwt loop
168 fchr[A]: 0 168 fchr[A]: 0
169 fchr[C]: 235897 169 fchr[C]: 235897
170 fchr[G]: 235897 170 fchr[G]: 235897
199 numLines: 3939 199 numLines: 3939
200 ebwtTotLen: 252096 200 ebwtTotLen: 252096
201 ebwtTotSz: 252096 201 ebwtTotSz: 252096
202 color: 0 202 color: 0
203 reverse: 1 203 reverse: 1
204 Total time for backward call to driver() for mirror index: 00:00:00 204 Total time for backward call to driver() for mirror index: 00:00:01
205 Settings: 205 Settings:
206 Output files: "BS_GA.*.bt2" 206 Output files: "BS_GA.*.bt2"
207 Line rate: 6 (line is 64 bytes) 207 Line rate: 6 (line is 64 bytes)
208 Lines per side: 1 (side is 64 bytes) 208 Lines per side: 1 (side is 64 bytes)
209 Offset rate: 4 (one in 16) 209 Offset rate: 4 (one in 16)
262 Entering Ebwt loop 262 Entering Ebwt loop
263 Getting block 1 of 1 263 Getting block 1 of 1
264 No samples; assembling all-inclusive block 264 No samples; assembling all-inclusive block
265 Sorting block of length 756159 for bucket 1 265 Sorting block of length 756159 for bucket 1
266 (Using difference cover) 266 (Using difference cover)
267 Sorting block time: 00:00:01 267 Sorting block time: 00:00:00
268 Returning block of 756160 for bucket 1 268 Returning block of 756160 for bucket 1
269 Exited Ebwt loop 269 Exited Ebwt loop
270 fchr[A]: 0 270 fchr[A]: 0
271 fchr[C]: 386401 271 fchr[C]: 386401
272 fchr[G]: 533276 272 fchr[G]: 533276
301 numLines: 3939 301 numLines: 3939
302 ebwtTotLen: 252096 302 ebwtTotLen: 252096
303 ebwtTotSz: 252096 303 ebwtTotSz: 252096
304 color: 0 304 color: 0
305 reverse: 0 305 reverse: 0
306 Total time for call to driver() for forward index: 00:00:01 306 Total time for call to driver() for forward index: 00:00:00
307 Reading reference sizes 307 Reading reference sizes
308 Time reading reference sizes: 00:00:00 308 Time reading reference sizes: 00:00:00
309 Calculating joined length 309 Calculating joined length
310 Writing header 310 Writing header
311 Reserving space for joined string 311 Reserving space for joined string
345 Entering Ebwt loop 345 Entering Ebwt loop
346 Getting block 1 of 1 346 Getting block 1 of 1
347 No samples; assembling all-inclusive block 347 No samples; assembling all-inclusive block
348 Sorting block of length 756159 for bucket 1 348 Sorting block of length 756159 for bucket 1
349 (Using difference cover) 349 (Using difference cover)
350 Sorting block time: 00:00:00 350 Sorting block time: 00:00:01
351 Returning block of 756160 for bucket 1 351 Returning block of 756160 for bucket 1
352 Exited Ebwt loop 352 Exited Ebwt loop
353 fchr[A]: 0 353 fchr[A]: 0
354 fchr[C]: 386401 354 fchr[C]: 386401
355 fchr[G]: 533276 355 fchr[G]: 533276
384 numLines: 3939 384 numLines: 3939
385 ebwtTotLen: 252096 385 ebwtTotLen: 252096
386 ebwtTotSz: 252096 386 ebwtTotSz: 252096
387 color: 0 387 color: 0
388 reverse: 1 388 reverse: 1
389 Total time for backward call to driver() for mirror index: 00:00:00 389 Total time for backward call to driver() for mirror index: 00:00:01
390 Running bismark with: 'bismark --bam --gzip --temp_dir /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me -o /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat' 390 Running bismark with: 'bismark --bam --gzip --temp_dir /tmp/tmpvcY9eC -o /tmp/tmpvcY9eC/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpProAS5 input_1.fq.gz'
391 Path to Bowtie 2 specified as: bowtie2 391 Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
392 Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.4])
393 Output format is BAM (default) 392 Output format is BAM (default)
394 Alignments will be written out in BAM format. Samtools found here: '/Users/scholtalbers/miniconda3/envs/mulled-v1-7f230b3d24f9f00e91e72af479ffae49907f4592b1a7a4b05436e0a99567150a/bin/samtools' 393 Alignments will be written out in BAM format. Samtools found here: '/home/abretaud/miniconda3/envs/mulled-v1-9f2317dbfb405ed6926c55752e5c11678eee3256a6ea680d1c0f912251153030/bin/samtools'
395 Reference genome folder provided is /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/ (absolute path is '/private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/)' 394 Reference genome folder provided is /tmp/tmpProAS5/ (absolute path is '/tmp/tmpProAS5/)'
396 FastQ format specified 395 FastQ format specified
397 396
398 Input files to be analysed (in current folder '/private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/job_working_directory/000/3/working'): 397 Input files to be analysed (in current folder '/tmp/tmpq6T4hb/job_working_directory/000/4/working'):
399 /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat 398 input_1.fq.gz
400 Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) 399 Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
401 Created output directory /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/! 400 Created output directory /tmp/tmpvcY9eC/results/!
402 401
403 Output will be written into the directory: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/ 402 Output will be written into the directory: /tmp/tmpvcY9eC/results/
404 403
405 Using temp directory: /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me 404 Using temp directory: /tmp/tmpvcY9eC
406 Temporary files will be written into the directory: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/ 405 Temporary files will be written into the directory: /tmp/tmpvcY9eC/
407 Setting parallelization to single-threaded (default) 406 Setting parallelization to single-threaded (default)
408 407
409 Current working directory is: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/job_working_directory/000/3/working 408 Summary of all aligner options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
410 409 Current working directory is: /tmp/tmpq6T4hb/job_working_directory/000/4/working
411 Now reading in and storing sequence information of the genome specified in: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/ 410
411 Now reading in and storing sequence information of the genome specified in: /tmp/tmpProAS5/
412 412
413 chr chrY_JH584300_random (182347 bp) 413 chr chrY_JH584300_random (182347 bp)
414 chr chrY_JH584301_random (259875 bp) 414 chr chrY_JH584301_random (259875 bp)
415 chr chrY_JH584302_random (155838 bp) 415 chr chrY_JH584302_random (155838 bp)
416 chr chrY_JH584303_random (158099 bp) 416 chr chrY_JH584303_random (158099 bp)
419 419
420 Single-end alignments will be performed 420 Single-end alignments will be performed
421 ======================================= 421 =======================================
422 422
423 Input file is in FastQ format 423 Input file is in FastQ format
424 Writing a C -> T converted version of the input file dataset_2.dat to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz 424 Writing a C -> T converted version of the input file input_1.fq.gz to /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
425 425
426 Created C -> T converted version of the FastQ file dataset_2.dat (44115 sequences in total) 426 Created C -> T converted version of the FastQ file input_1.fq.gz (44115 sequences in total)
427 427
428 Input file is dataset_2.dat_C_to_T.fastq.gz (FastQ) 428 Input file is input_1.fq.gz_C_to_T.fastq.gz (FastQ)
429 429
430 Now running 2 instances of Bowtie 2 against the bisulfite genome of /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet 430 Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpProAS5/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
431 431
432 Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --norc) 432 Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --norc)
433 Using Bowtie 2 index: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/Bisulfite_Genome/CT_conversion/BS_CT 433 Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/CT_conversion/BS_CT
434 434
435 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU 435 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU
436 Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --nofw) 436 Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --nofw)
437 Using Bowtie 2 index: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/Bisulfite_Genome/GA_conversion/BS_GA 437 Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/GA_conversion/BS_GA
438 438
439 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU 439 Found first alignment: 1_1 4 * 0 0 * * 0 0 TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE YT:Z:UU
440 440
441 >>> Writing bisulfite mapping results to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_bismark_bt2.bam <<< 441 >>> Writing bisulfite mapping results to /tmp/tmpvcY9eC/results/input_1_bismark_bt2.bam <<<
442 442
443 Unmapped sequences will be written to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_unmapped_reads.fq.gz 443 Unmapped sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_unmapped_reads.fq.gz
444 Ambiguously mapping sequences will be written to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_ambiguous_reads.fq.gz 444 Ambiguously mapping sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_ambiguous_reads.fq.gz
445 445
446 Reading in the sequence file /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat 446 Reading in the sequence file input_1.fq.gz
447 Processed 44115 sequences in total 447 Processed 44115 sequences in total
448 448
449 449
450 Successfully deleted the temporary file /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz 450 Successfully deleted the temporary file /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
451 451
452 Final Alignment report 452 Final Alignment report
453 ====================== 453 ======================
454 Sequences analysed in total: 44115 454 Sequences analysed in total: 44115
455 Number of alignments with a unique best hit from the different alignments: 554 455 Number of alignments with a unique best hit from the different alignments: 554