Mercurial > repos > bgruening > bismark

diff test-data/summary_mate_two_samples.txt @ 21:120b7b35e442 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit 8fdc76a99a9dcf34549898a208317607afd18798"
author bgruening
date Thu, 22 Apr 2021 17:05:46 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/summary_mate_two_samples.txt	Thu Apr 22 17:05:46 2021 +0000
@@ -0,0 +1,585 @@
+Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
+Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpfw7btd9x'
+Writing bisulfite genomes out into a single MFA (multi FastA) file
+
+Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
+
+Step I - Prepare genome folders - completed
+
+
+
+Total number of conversions performed:
+C->T:	146875
+G->A:	150504
+
+Step II - Genome bisulfite conversions - completed
+
+
+Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer
+Please be aware that this process can - depending on genome size - take several hours!
+Settings:
+  Output files: "BS_CT.*.bt2"
+  Line rate: 6 (line is 64 bytes)
+  Lines per side: 1 (side is 64 bytes)
+  Offset rate: 4 (one in 16)
+  FTable chars: 10
+  Strings: unpacked
+  Max bucket size: default
+  Max bucket size, sqrt multiplier: default
+  Max bucket size, len divisor: 4
+  Difference-cover sample period: 1024
+  Endianness: little
+  Actual local endianness: little
+  Sanity checking: disabled
+  Assertions: disabled
+  Random seed: 0
+  Sizeofs: void*:8, int:4, long:8, size_t:8
+Input files DNA, FASTA:
+  genome_mfa.CT_conversion.fa
+Building a SMALL index
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 235897
+fchr[G]: 235897
+fchr[T]: 386401
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_CT.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_CT.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 0
+Total time for call to driver() for forward index: 00:00:00
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+  Time to reverse reference sequence: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 235897
+fchr[G]: 235897
+fchr[T]: 386401
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_CT.rev.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_CT.rev.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 1
+Total time for backward call to driver() for mirror index: 00:00:01
+Settings:
+  Output files: "BS_GA.*.bt2"
+  Line rate: 6 (line is 64 bytes)
+  Lines per side: 1 (side is 64 bytes)
+  Offset rate: 4 (one in 16)
+  FTable chars: 10
+  Strings: unpacked
+  Max bucket size: default
+  Max bucket size, sqrt multiplier: default
+  Max bucket size, len divisor: 4
+  Difference-cover sample period: 1024
+  Endianness: little
+  Actual local endianness: little
+  Sanity checking: disabled
+  Assertions: disabled
+  Random seed: 0
+  Sizeofs: void*:8, int:4, long:8, size_t:8
+Input files DNA, FASTA:
+  genome_mfa.GA_conversion.fa
+Building a SMALL index
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 386401
+fchr[G]: 533276
+fchr[T]: 533276
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_GA.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_GA.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 0
+Total time for call to driver() for forward index: 00:00:00
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+  Time to reverse reference sequence: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 386401
+fchr[G]: 533276
+fchr[T]: 533276
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_GA.rev.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_GA.rev.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 1
+Total time for backward call to driver() for mirror index: 00:00:01
+Running bismark with: 'bismark --bam --temp_dir /tmp/tmp0n2gudqm -o /tmp/tmp0n2gudqm/results --quiet --gzip --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpfw7btd9x -1 input1.fq_1.fq,input2.fq_1.fq -2 input1.fq_2.fq,input2.fq_2.fq -I 0 -X 500'
+Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
+Output format is BAM (default)
+Alignments will be written out in BAM format. Samtools found here: '/usr/local/bin/samtools'
+Reference genome folder provided is /tmp/tmpfw7btd9x/	(absolute path is '/tmp/tmpfw7btd9x/)'
+FastQ format specified
+
+Input files to be analysed (in current folder '/tmp/tmpfl_1r4y7/job_working_directory/000/17/working'):
+input1.fq_1.fq
+input1.fq_2.fq
+input2.fq_1.fq
+input2.fq_2.fq
+Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
+Created output directory /tmp/tmp0n2gudqm/results/!
+
+Output will be written into the directory: /tmp/tmp0n2gudqm/results/
+
+Using temp directory: /tmp/tmp0n2gudqm
+Temporary files will be written into the directory: /tmp/tmp0n2gudqm/
+Setting parallelization to single-threaded (default)
+
+Summary of all aligner options:	-q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+Current working directory is: /tmp/tmpfl_1r4y7/job_working_directory/000/17/working
+
+Now reading in and storing sequence information of the genome specified in: /tmp/tmpfw7btd9x/
+
+chr chrY_JH584300_random (182347 bp)
+chr chrY_JH584301_random (259875 bp)
+chr chrY_JH584302_random (155838 bp)
+chr chrY_JH584303_random (158099 bp)
+
+Single-core mode: setting pid to 1
+
+Paired-end alignments will be performed
+=======================================
+
+The provided filenames for paired-end alignments are input1.fq_1.fq and input1.fq_2.fq
+Input files are in FastQ format
+Writing a C -> T converted version of the input file input1.fq_1.fq to /tmp/tmp0n2gudqm/input1.fq_1.fq_C_to_T.fastq.gz
+
+Created C -> T converted version of the FastQ file input1.fq_1.fq (1000 sequences in total)
+
+Writing a G -> A converted version of the input file input1.fq_2.fq to /tmp/tmp0n2gudqm/input1.fq_2.fq_G_to_A.fastq.gz
+
+Created G -> A converted version of the FastQ file input1.fq_2.fq (1000 sequences in total)
+
+Input files are input1.fq_1.fq_C_to_T.fastq.gz and input1.fq_2.fq_G_to_A.fastq.gz (FastQ)
+Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpfw7btd9x/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/tmp0n2gudqm/input1.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input1.fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --norc))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/tmp0n2gudqm/input1.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input1.fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --nofw))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+
+>>> Writing bisulfite mapping results to input1.fq_1_bismark_bt2_pe.bam <<<
+
+Unmapped sequences will be written to input1.fq_1.fq_unmapped_reads_1.fq.gz and input1.fq_2.fq_unmapped_reads_2.fq.gz
+Ambiguously mapping sequences will be written to input1.fq_1.fq_ambiguous_reads_1.fq.gz and input1.fq_2.fq_ambiguous_reads_2.fq.gz
+
+Reading in the sequence files input1.fq_1.fq and input1.fq_2.fq
+Processed 1000 sequences in total
+
+
+Successfully deleted the temporary files /tmp/tmp0n2gudqm/input1.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input1.fq_2.fq_G_to_A.fastq.gz
+
+Final Alignment report
+======================
+Sequence pairs analysed in total:	1000
+Number of paired-end alignments with a unique best hit:	0
+Mapping efficiency:	0.0%
+
+Sequence pairs with no alignments under any condition:	1000
+Sequence pairs did not map uniquely:	0
+Sequence pairs which were discarded because genomic sequence could not be extracted:	0
+
+Number of sequence pairs with unique best (first) alignment came from the bowtie output:
+CT/GA/CT:	0	((converted) top strand)
+GA/CT/CT:	0	(complementary to (converted) top strand)
+GA/CT/GA:	0	(complementary to (converted) bottom strand)
+CT/GA/GA:	0	((converted) bottom strand)
+
+Number of alignments to (merely theoretical) complementary strands being rejected in total:	0
+
+Final Cytosine Methylation Report
+=================================
+Total number of C's analysed:	0
+
+Total methylated C's in CpG context:	0
+Total methylated C's in CHG context:	0
+Total methylated C's in CHH context:	0
+Total methylated C's in Unknown context:	0
+
+Total unmethylated C's in CpG context:	0
+Total unmethylated C's in CHG context:	0
+Total unmethylated C's in CHH context:	0
+Total unmethylated C's in Unknown context:	0
+
+Can't determine percentage of methylated Cs in CpG context if value was 0
+Can't determine percentage of methylated Cs in CHG context if value was 0
+Can't determine percentage of methylated Cs in CHH context if value was 0
+Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0
+
+
+Bismark completed in 0d 0h 0m 6s
+
+====================
+Bismark run complete
+====================
+
+Single-core mode: setting pid to 1
+
+Paired-end alignments will be performed
+=======================================
+
+The provided filenames for paired-end alignments are input2.fq_1.fq and input2.fq_2.fq
+Input files are in FastQ format
+Writing a C -> T converted version of the input file input2.fq_1.fq to /tmp/tmp0n2gudqm/input2.fq_1.fq_C_to_T.fastq.gz
+
+Created C -> T converted version of the FastQ file input2.fq_1.fq (1000 sequences in total)
+
+Writing a G -> A converted version of the input file input2.fq_2.fq to /tmp/tmp0n2gudqm/input2.fq_2.fq_G_to_A.fastq.gz
+
+Created G -> A converted version of the FastQ file input2.fq_2.fq (1000 sequences in total)
+
+Input files are input2.fq_1.fq_C_to_T.fastq.gz and input2.fq_2.fq_G_to_A.fastq.gz (FastQ)
+Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpfw7btd9x/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/tmp0n2gudqm/input2.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input2.fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --norc))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/tmp0n2gudqm/input2.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input2.fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --nofw))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+
+>>> Writing bisulfite mapping results to input2.fq_1_bismark_bt2_pe.bam <<<
+
+Unmapped sequences will be written to input2.fq_1.fq_unmapped_reads_1.fq.gz and input2.fq_2.fq_unmapped_reads_2.fq.gz
+Ambiguously mapping sequences will be written to input2.fq_1.fq_ambiguous_reads_1.fq.gz and input2.fq_2.fq_ambiguous_reads_2.fq.gz
+
+Reading in the sequence files input2.fq_1.fq and input2.fq_2.fq
+Processed 1000 sequences in total
+
+
+Successfully deleted the temporary files /tmp/tmp0n2gudqm/input2.fq_1.fq_C_to_T.fastq.gz and /tmp/tmp0n2gudqm/input2.fq_2.fq_G_to_A.fastq.gz
+
+Final Alignment report
+======================
+Sequence pairs analysed in total:	1000
+Number of paired-end alignments with a unique best hit:	0
+Mapping efficiency:	0.0%
+
+Sequence pairs with no alignments under any condition:	1000
+Sequence pairs did not map uniquely:	0
+Sequence pairs which were discarded because genomic sequence could not be extracted:	0
+
+Number of sequence pairs with unique best (first) alignment came from the bowtie output:
+CT/GA/CT:	0	((converted) top strand)
+GA/CT/CT:	0	(complementary to (converted) top strand)
+GA/CT/GA:	0	(complementary to (converted) bottom strand)
+CT/GA/GA:	0	((converted) bottom strand)
+
+Number of alignments to (merely theoretical) complementary strands being rejected in total:	0
+
+Final Cytosine Methylation Report
+=================================
+Total number of C's analysed:	0
+
+Total methylated C's in CpG context:	0
+Total methylated C's in CHG context:	0
+Total methylated C's in CHH context:	0
+Total methylated C's in Unknown context:	0
+
+Total unmethylated C's in CpG context:	0
+Total unmethylated C's in CHG context:	0
+Total unmethylated C's in CHH context:	0
+Total unmethylated C's in Unknown context:	0
+
+Can't determine percentage of methylated Cs in CpG context if value was 0
+Can't determine percentage of methylated Cs in CHG context if value was 0
+Can't determine percentage of methylated Cs in CHH context if value was 0
+Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0
+
+
+Bismark completed in 0d 0h 0m 8s
+
+====================
+Bismark run complete
+====================
+
+Merging bams with: '['samtools', 'merge', '-@', '1', '-f', '/tmp/tmp0n2gudqm/results/tmpnqe_dadr', '/tmp/tmp0n2gudqm/results/input1.fq_1_bismark_bt2_pe.bam', '/tmp/tmp0n2gudqm/results/input2.fq_1_bismark_bt2_pe.bam']'