--- a/test-data/summary.txt	Wed Jun 05 07:44:26 2019 -0400
+++ b/test-data/summary.txt	Tue Jul 30 06:30:36 2019 -0400
@@ -1,8 +1,8 @@
 Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
-Generating index with: 'bismark_genome_preparation --bowtie2 /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf'
+Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpProAS5'
 Writing bisulfite genomes out into a single MFA (multi FastA) file
 
-Bisulfite Genome Indexer version v0.20.0 (last modified 26 April 2018)
+Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
 
 Step I - Prepare genome folders - completed
 
@@ -79,7 +79,7 @@
   No samples; assembling all-inclusive block
   Sorting block of length 756159 for bucket 1
   (Using difference cover)
-  Sorting block time: 00:00:01
+  Sorting block time: 00:00:00
 Returning block of 756160 for bucket 1
 Exited Ebwt loop
 fchr[A]: 0
@@ -118,7 +118,7 @@
     ebwtTotSz: 252096
     color: 0
     reverse: 0
-Total time for call to driver() for forward index: 00:00:01
+Total time for call to driver() for forward index: 00:00:00
 Reading reference sizes
   Time reading reference sizes: 00:00:00
 Calculating joined length
@@ -162,7 +162,7 @@
   No samples; assembling all-inclusive block
   Sorting block of length 756159 for bucket 1
   (Using difference cover)
-  Sorting block time: 00:00:00
+  Sorting block time: 00:00:01
 Returning block of 756160 for bucket 1
 Exited Ebwt loop
 fchr[A]: 0
@@ -201,7 +201,7 @@
     ebwtTotSz: 252096
     color: 0
     reverse: 1
-Total time for backward call to driver() for mirror index: 00:00:00
+Total time for backward call to driver() for mirror index: 00:00:01
 Settings:
   Output files: "BS_GA.*.bt2"
   Line rate: 6 (line is 64 bytes)
@@ -264,7 +264,7 @@
   No samples; assembling all-inclusive block
   Sorting block of length 756159 for bucket 1
   (Using difference cover)
-  Sorting block time: 00:00:01
+  Sorting block time: 00:00:00
 Returning block of 756160 for bucket 1
 Exited Ebwt loop
 fchr[A]: 0
@@ -303,7 +303,7 @@
     ebwtTotSz: 252096
     color: 0
     reverse: 0
-Total time for call to driver() for forward index: 00:00:01
+Total time for call to driver() for forward index: 00:00:00
 Reading reference sizes
   Time reading reference sizes: 00:00:00
 Calculating joined length
@@ -347,7 +347,7 @@
   No samples; assembling all-inclusive block
   Sorting block of length 756159 for bucket 1
   (Using difference cover)
-  Sorting block time: 00:00:00
+  Sorting block time: 00:00:01
 Returning block of 756160 for bucket 1
 Exited Ebwt loop
 fchr[A]: 0
@@ -386,29 +386,29 @@
     ebwtTotSz: 252096
     color: 0
     reverse: 1
-Total time for backward call to driver() for mirror index: 00:00:00
-Running bismark with: 'bismark --bam --gzip --temp_dir /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me -o /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat'
-Path to Bowtie 2 specified as: bowtie2
-Bowtie seems to be working fine (tested command 'bowtie2 --version' [2.3.4])
+Total time for backward call to driver() for mirror index: 00:00:01
+Running bismark with: 'bismark --bam --gzip --temp_dir /tmp/tmpvcY9eC -o /tmp/tmpvcY9eC/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpProAS5 input_1.fq.gz'
+Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
 Output format is BAM (default)
-Alignments will be written out in BAM format. Samtools found here: '/Users/scholtalbers/miniconda3/envs/mulled-v1-7f230b3d24f9f00e91e72af479ffae49907f4592b1a7a4b05436e0a99567150a/bin/samtools'
-Reference genome folder provided is /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/	(absolute path is '/private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/)'
+Alignments will be written out in BAM format. Samtools found here: '/home/abretaud/miniconda3/envs/mulled-v1-9f2317dbfb405ed6926c55752e5c11678eee3256a6ea680d1c0f912251153030/bin/samtools'
+Reference genome folder provided is /tmp/tmpProAS5/	(absolute path is '/tmp/tmpProAS5/)'
 FastQ format specified
 
-Input files to be analysed (in current folder '/private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/job_working_directory/000/3/working'):
-/private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat
+Input files to be analysed (in current folder '/tmp/tmpq6T4hb/job_working_directory/000/4/working'):
+input_1.fq.gz
 Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
-Created output directory /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/!
+Created output directory /tmp/tmpvcY9eC/results/!
 
-Output will be written into the directory: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/
+Output will be written into the directory: /tmp/tmpvcY9eC/results/
 
-Using temp directory: /var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me
-Temporary files will be written into the directory: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/
+Using temp directory: /tmp/tmpvcY9eC
+Temporary files will be written into the directory: /tmp/tmpvcY9eC/
 Setting parallelization to single-threaded (default)
 
-Current working directory is: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/job_working_directory/000/3/working
+Summary of all aligner options:	-q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
+Current working directory is: /tmp/tmpq6T4hb/job_working_directory/000/4/working
 
-Now reading in and storing sequence information of the genome specified in: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/
+Now reading in and storing sequence information of the genome specified in: /tmp/tmpProAS5/
 
 chr chrY_JH584300_random (182347 bp)
 chr chrY_JH584301_random (259875 bp)
@@ -421,33 +421,33 @@
 =======================================
 
 Input file is in FastQ format
-Writing a C -> T converted version of the input file dataset_2.dat to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz
+Writing a C -> T converted version of the input file input_1.fq.gz to /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
 
-Created C -> T converted version of the FastQ file dataset_2.dat (44115 sequences in total)
+Created C -> T converted version of the FastQ file input_1.fq.gz (44115 sequences in total)
 
-Input file is dataset_2.dat_C_to_T.fastq.gz (FastQ)
+Input file is input_1.fq.gz_C_to_T.fastq.gz (FastQ)
 
-Now running 2 instances of Bowtie 2 against the bisulfite genome of /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
+Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpProAS5/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet
 
-Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --norc)
-Using Bowtie 2 index: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/Bisulfite_Genome/CT_conversion/BS_CT
+Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --norc)
+Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/CT_conversion/BS_CT
 
 Found first alignment:	1_1	4	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UU
-Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --nofw)
-Using Bowtie 2 index: /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmp4_4hiluf/Bisulfite_Genome/GA_conversion/BS_GA
+Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz with options -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --quiet --nofw)
+Using Bowtie 2 index: /tmp/tmpProAS5/Bisulfite_Genome/GA_conversion/BS_GA
 
 Found first alignment:	1_1	4	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UU
 
->>> Writing bisulfite mapping results to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_bismark_bt2.bam <<<
+>>> Writing bisulfite mapping results to /tmp/tmpvcY9eC/results/input_1_bismark_bt2.bam <<<
 
-Unmapped sequences will be written to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_unmapped_reads.fq.gz
-Ambiguously mapping sequences will be written to /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/results/dataset_2.dat_ambiguous_reads.fq.gz
+Unmapped sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_unmapped_reads.fq.gz
+Ambiguously mapping sequences will be written to /tmp/tmpvcY9eC/results/input_1.fq.gz_ambiguous_reads.fq.gz
 
-Reading in the sequence file /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmpywNSSM/files/000/dataset_2.dat
+Reading in the sequence file input_1.fq.gz
 Processed 44115 sequences in total
 
 
-Successfully deleted the temporary file /private/var/folders/cf/k7c5rjhj1sggk6x8z1jnw4b80000gp/T/tmprjiux3me/dataset_2.dat_C_to_T.fastq.gz
+Successfully deleted the temporary file /tmp/tmpvcY9eC/input_1.fq.gz_C_to_T.fastq.gz
 
 Final Alignment report
 ======================