diff new/bismark_methylation_extractor @ 7:fcadce4d9a06 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit b'e6ee273f75fff61d1e419283fa8088528cf59470\n'
author bgruening
date Sat, 06 May 2017 13:18:09 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/new/bismark_methylation_extractor	Sat May 06 13:18:09 2017 -0400
@@ -0,0 +1,5875 @@
+#!/usr/bin/perl
+use warnings;
+use strict;
+$|++;
+use Getopt::Long;
+use Cwd;
+use Carp;
+use FindBin qw($Bin);
+use lib "$Bin/../lib";
+
+## This program is Copyright (C) 2010-15, Felix Krueger (felix.krueger@babraham.ac.uk)
+
+## This program is free software: you can redistribute it and/or modify
+## it under the terms of the GNU General Public License as published by
+## the Free Software Foundation, either version 3 of the License, or
+## (at your option) any later version.
+
+## This program is distributed in the hope that it will be useful,
+## but WITHOUT ANY WARRANTY; without even the implied warranty of
+## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+## GNU General Public License for more details.
+
+## You should have received a copy of the GNU General Public License
+## along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+my @filenames; # input files
+my %counting;
+my $parent_dir = getcwd();
+
+my %fhs;
+
+my $version = 'v0.14.3';
+my ($ignore,$genomic_fasta,$single,$paired,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore) = process_commandline();
+
+
+### only needed for bedGraph output
+my @sorting_files; # if files are to be written to bedGraph format, these are the methylation extractor output files
+my @methylcalls = qw (0 0 0); # [0] = methylated, [1] = unmethylated, [2] = total
+my @bedfiles;
+
+### only needed for genome-wide cytosine methylation report
+my %chromosomes;
+
+my %mbias_1;
+my %mbias_2;
+
+
+##############################################################################################
+### Summarising Run Parameters
+##############################################################################################
+
+### METHYLATION EXTRACTOR
+
+warn "Summarising Bismark methylation extractor parameters:\n";
+warn '='x63,"\n";
+
+if ($single){
+  if ($vanilla){
+    warn "Bismark single-end vanilla format specified\n";
+  }
+  else{
+    warn "Bismark single-end SAM format specified (default)\n"; # default
+  }
+}
+elsif ($paired){
+  if ($vanilla){
+    warn "Bismark paired-end vanilla format specified\n";
+  }
+  else{
+    warn "Bismark paired-end SAM format specified (default)\n"; # default
+  }
+}
+
+warn "Number of cores to be used: $multicore\n";
+
+if ($single){
+  if ($ignore){
+    warn "First $ignore bp will be disregarded when processing the methylation call string\n";
+  }
+  if ($ignore_3prime){
+    warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string\n";
+  }
+
+}
+else{ ## paired-end
+  if ($ignore){
+    warn "First $ignore bp will be disregarded when processing the methylation call string of Read 1\n";
+  }
+  if ($ignore_r2){
+    warn "First $ignore_r2 bp will be disregarded when processing the methylation call string of Read 2\n";
+  }
+
+  if ($ignore_3prime){
+    warn "Last $ignore_3prime bp will be disregarded when processing the methylation call string of Read 1\n";
+  }
+  if ($ignore_3prime_r2){
+    warn "Last $ignore_3prime_r2 bp will be disregarded when processing the methylation call string of Read 2\n";
+  }
+
+
+}
+
+
+if ($full){
+  warn "Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated\n";
+}
+if ($merge_non_CpG){
+  warn "Merge CHG and CHH context to non-CpG context specified\n";
+}
+### output directory
+if ($output_dir eq ''){
+  warn "Output will be written to the current directory ('$parent_dir')\n";
+}
+else{
+  warn "Output path specified as: $output_dir\n";
+}
+
+
+sleep (1);
+
+### BEDGRAPH
+
+if ($bedGraph){
+  warn "\n\nSummarising bedGraph parameters:\n";
+  warn '='x63,"\n";
+
+  if ($counts){
+    warn "Generating additional output in bedGraph and coverage format\nbedGraph format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage>\ncoverage format:\t<Chromosome> <Start Position> <End Position> <Methylation Percentage> <count methylated> <count non-methylated>\n\n";
+  }
+  else{
+    warn "Generating additional sorted output in bedGraph format (output format: <Chromosome> <Start Position> <End Position> <Methylation Percentage>)\n";
+  }
+
+  ### Zero-based coordinates
+  if ($zero){
+    warn "Writing out an additional coverage file (ending in zero.cov) with 0-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n";
+  }
+
+  warn "Using a cutoff of $coverage_threshold read(s) to report cytosine positions\n";
+
+  if ($CX_context){
+    warn "Reporting and sorting methylation information for all cytosine context (sorting may take a long time, you have been warned ...)\n";
+  }
+  else{ # default
+    $CpG_only = 1;
+    warn "Reporting and sorting cytosine methylation information in CpG context only (default)\n";
+  }
+
+  if ($remove){
+    warn "White spaces in read ID names will be removed prior to sorting\n";
+  }
+
+  if ($ample_mem){
+    warn "Sorting chromosomal postions for the bedGraph step using arrays instead of using UNIX sort\n";
+  }
+  elsif (defined $sort_size){
+    warn "The bedGraph UNIX sort command will use the following memory setting:\t'$sort_size'. Temporary directory used for sorting is the output directory\n";
+  }
+  else{
+    warn "Setting a default memory usage for the bedGraph UNIX sort command to 2GB\n";
+  }
+
+
+
+  sleep (1);
+
+  if ($cytosine_report){
+    warn "\n\nSummarising genome-wide cytosine methylation report parameters:\n";
+    warn '='x63,"\n";
+    warn "Generating comprehensive genome-wide cytosine report\n(output format: <Chromosome> <Position> <Strand> <count methylated> <count non-methylated>  <C-context>  <trinucleotide context> )\n";
+
+
+    if ($CX_context){
+      warn "Reporting methylation for all cytosine contexts. Be aware that this will generate enormous files\n";
+    }
+    else{ # default
+      $CpG_only = 1;
+      warn "Reporting cytosine methylation in CpG context only (default)\n";
+    }
+
+    if ($split_by_chromosome){
+      warn "Splitting the cytosine report output up into individual files for each chromosome\n";
+    }
+
+    ### Zero-based coordinates
+    if ($zero){
+      warn "Using zero-based start and 1-based end genomic coordinates (zero-based, half-open; user-defined)\n";
+    }
+    else{ # default, 1-based coords
+      warn "Using 1-based genomic coordinates (default)\n";
+    }
+
+    ### GENOME folder
+    if ($genome_folder){
+      unless ($genome_folder =~/\/$/){
+	$genome_folder =~ s/$/\//;
+      }
+      warn "Genome folder was specified as $genome_folder\n";
+    }
+    else{
+      $genome_folder  = '/data/public/Genomes/Mouse/NCBIM37/';
+      warn "Using the default genome folder /data/public/Genomes/Mouse/NCBIM37/\n";
+    }
+    sleep (1);
+  }
+}
+
+warn "\n";
+sleep (1);
+
+######################################################
+### PROCESSING FILES
+######################################################
+
+foreach my $filename (@filenames){
+  # resetting counters and filehandles
+  %fhs = ();
+  %counting =(
+	      total_meCHG_count            => 0,
+	      total_meCHH_count            => 0,
+	      total_meCpG_count            => 0,
+	      total_unmethylated_CHG_count => 0,
+	      total_unmethylated_CHH_count => 0,
+	      total_unmethylated_CpG_count => 0,
+	      sequences_count              => 0,
+	      methylation_call_strings     => 0,
+	     );
+
+  @sorting_files = ();
+  @bedfiles = ();
+
+  %mbias_1 = ();
+  %mbias_2 = ();
+
+
+  ### performing a quick check to see if a paired-end SAM file has been sorted by positions which does interfere with the logic used by the extractor
+  unless ($vanilla){
+    if ($paired){
+      test_positional_sorting($filename);
+    }
+  }
+
+  my ($pid,$pids,$report_basename) = process_Bismark_results_file($filename);
+
+  if ($pid == 0){
+    warn "Finished processing child process. Exiting..\n";
+
+    #  ### Closing all filehandles of the child process so that the Bismark methylation extractor output doesn't get truncated due to buffering issues
+    #     foreach my $fh (keys %fhs) {
+    #       if ($fh =~ /^[1230]$/) {
+    # 	foreach my $context (keys %{$fhs{$fh}}) {
+    # 	  $fhs{$fh}->{$context}->flush;
+    # 	}
+    #       }
+    #       else{
+    # 	$fhs{$fh}->flush;
+    #       }
+    # }
+    exit 0;
+  }
+
+  ###
+  if ($pid and $multicore > 1){
+    warn "Now waiting for all child processes to complete\n";
+    sleep(1);
+
+    ### we need to ensure that we wait for all child processes to be finished before continuing
+    # warn "here are the child IDs: @$pids\n";
+    # warn "Looping through the child process IDs:\n";
+
+    foreach my $id (@$pids){
+      # print "$id\t";
+      my $kid = waitpid ($id,0);
+      # print "Returned: $kid\nExit status: $?\n";
+      unless ($? == 0){
+	warn "\nChild process terminated with exit signal: '$?'\n\n";
+      }
+    }
+  }
+
+  ### Closing all filehandles so that the Bismark methylation extractor output doesn't get truncated due to buffering issues
+  foreach my $fh (keys %fhs) {
+    if ($fh =~ /^[1230]$/) {
+      foreach my $context (keys %{$fhs{$fh}}) {
+	close $fhs{$fh}->{$context} or die $!;
+      }
+    }
+    else{
+      close $fhs{$fh} or die $!;
+    }
+  }
+
+  ### We need to stitch together a main splitting report from all individual parent/child processes
+  if ($multicore > 1){
+    merge_individual_splitting_reports($report_basename);
+    print_splitting_report();
+
+    merge_individual_mbias_reports($report_basename); # this updates the main %mbias_1 and  %mbias_2 data structures so we can proceed normally
+
+  }
+
+  unless ($mbias_off){
+    ### printing out all M-Bias data
+    produce_mbias_plots ($filename);    produce_mbias_plots ($filename);
+
+  }
+
+  unless ($mbias_only){
+    delete_unused_files();
+  }
+
+  if ($bedGraph){
+
+    my $out = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified
+    $out =~ s/gz$//;
+    $out =~ s/sam$//;
+    $out =~ s/bam$//;
+    $out =~ s/txt$//;
+    $out =~ s/$/bedGraph/;
+
+    my $bedGraph_output = $out;
+    my @args;
+
+    if ($remove){
+      push @args, '--remove';
+    }
+    if ($CX_context){
+      push @args, '--CX_context';
+    }
+    if ($no_header){
+      push @args, '--no_header';
+    }
+    if ($gazillion){
+      push @args, '--gazillion';
+    }
+    if ($ample_mem){
+      push @args, '--ample_memory';
+    }
+    if ($zero){
+      push @args, "--zero";
+    }
+
+    #   if ($counts){
+    #      push @args, "--counts";
+    #   }
+
+    push @args, "--buffer_size $sort_size";
+    push @args, "--cutoff $coverage_threshold";
+    push @args, "--output $bedGraph_output";
+    push @args, "--dir '$output_dir'";
+
+    ### adding all files to be sorted to @args
+    foreach my $f (@sorting_files){
+      push @args, $f;
+    }
+
+    #  print join "\t",@args,"\n";
+
+    system ("$Bin/bismark2bedGraph @args");
+
+    warn "Finished BedGraph conversion ...\n\n";
+    sleep(1);
+
+    # open (OUT,'>',$output_dir.$bedGraph_output) or die "Problems with the bedGraph output filename detected: file path: '$output_dir'\tfile name: '$bedGraph_output' $!";
+    # warn "Writing bedGraph to file: $bedGraph_output\n";
+    # process_bedGraph_output();
+    # close OUT or die $!;
+
+    ### genome-wide cytosine methylation report requires bedGraph processing anyway
+    if ($cytosine_report){
+
+      @args = (); # resetting @args
+      my $cytosine_out = $out;
+      $cytosine_out =~ s/bedGraph$//;
+
+      if ($CX_context){
+	$cytosine_out =~ s/$/CX_report.txt/;
+      }
+      else{
+	$cytosine_out =~ s/$/CpG_report.txt/;
+      }
+
+      push @args, "--output $cytosine_out";
+      push @args, "--dir '$output_dir'";
+      push @args, "--genome '$genome_folder'";
+      push @args, "--parent_dir '$parent_dir'";
+
+      if ($zero){
+	push @args, "--zero";
+      }
+      if ($CX_context){
+	push @args, '--CX_context';
+      }
+      if ($split_by_chromosome){
+	push @args, '--split_by_chromosome';
+      }
+
+      my $coverage_output = $bedGraph_output;
+      $coverage_output =~ s/bedGraph$/bismark.cov/;
+
+      push @args, $output_dir . $coverage_output; # this will be the infile
+
+      system ("$Bin/coverage2cytosine @args");
+      # generate_genome_wide_cytosine_report($bedGraph_output,$cytosine_out);
+      warn "\n\nFinished generating genome-wide cytosine report\n\n";
+    }
+  }
+}
+
+sub merge_individual_splitting_reports{
+
+  my $report_basename = shift;
+
+  my @splitting_reports; # only needed in multi-core mode to generate an overall report
+  foreach my $ext (1..$multicore){
+    push @splitting_reports, "$report_basename.$ext";
+  }
+  warn "\nMerging individual splitting reports into overall report: '$report_basename'\n";
+  warn "Merging from these individual files:\n";
+  print join ("\n",@splitting_reports),"\n\n";
+  sleep(1);
+
+  ##########
+  # resetting the counter first
+  %counting =(
+	      total_meCHG_count            => 0,
+	      total_meCHH_count            => 0,
+	      total_meCpG_count            => 0,
+	      total_unmethylated_CHG_count => 0,
+	      total_unmethylated_CHH_count => 0,
+	      total_unmethylated_CpG_count => 0,
+	      sequences_count              => 0,
+	      methylation_call_strings     => 0,
+	     );
+
+  # repopulating the merged counter
+  foreach my $file (@splitting_reports){
+    open (IR,$file) or die $!;
+    while (<IR>){
+      chomp;
+      my ($context,$count) = (split /\t/);
+      if ($context){
+	if ($context =~ /^Total C to T conversions in CpG context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_unmethylated_CpG_count} += $count;
+	}
+	elsif ($context =~ /^Total C to T conversions in CHG context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_unmethylated_CHG_count} += $count;
+	}
+	elsif ($context =~ /^Total C to T conversions in CHH context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_unmethylated_CHH_count} += $count;
+	}
+	elsif ($context =~ /^Total methylated C\'s in CpG context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_meCpG_count} += $count;
+	}
+	elsif ($context =~ /^Total methylated C\'s in CHG context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_meCHG_count} += $count;
+	}
+	elsif ($context =~ /^Total methylated C\'s in CHH context/){
+	  # warn "context: $context\ncount: $count\n";
+	  $counting{total_meCHH_count} += $count;
+	}
+	elsif ($context =~ /^line count/){
+	  # warn "Line count\ncount: $count\n";
+	  $counting{sequences_count} = $count; # always the same
+	}
+	elsif ($context =~ /^meth call strings/){
+	  # warn "Meth call strings\ncount: $count\n";
+	  $counting{methylation_call_strings} += $count;
+	}
+      }
+    }
+  }
+
+  # deleting the individual reports afterwards
+  foreach my $file (@splitting_reports){
+    unlink $file;
+  }
+}
+
+
+sub merge_individual_mbias_reports{
+
+  my $report_basename = shift;
+
+  my @mbias_reports; # only needed in multi-core mode to generate an overall report
+  foreach my $ext (1..$multicore){
+    push @mbias_reports, "$report_basename.${ext}.mbias";
+  }
+  warn "\nMerging individual M-bias reports into overall M-bias statistics from these $multicore individual files:\n";
+  print join ("\n",@mbias_reports),"\n\n";
+
+
+  ##########
+  # resetting the counters first, then repopulating them
+  %mbias_1 = ();
+  %mbias_2 = ();
+
+  # repopulating the merged counter
+  foreach my $file (@mbias_reports){
+    open (IR,$file) or die $!;
+
+    my $context;
+    my $read;
+
+    while (<IR>){
+      chomp;
+      # warn "$_\n"; sleep(1);
+      if ($_ =~ /context/){
+	$context = $1 if ($_ =~ /(\D{3}) context/);
+	# warn "Context set as $context\n";
+	
+	if ($_ =~ /R2/){
+	  $read = 'R2';
+	}
+	else{
+	  $read = 'R1';
+	}
+	# warn "Setting read identity to '$read'\n";
+	
+	# reading in 2 additional lines (===========, and header line)
+	$_ = <IR>;
+	#warn "discarding line $_\n";
+	$_ = <IR>;
+	#warn "discarding line $_\n";
+	next;
+      }
+      else{
+
+	if ($_ eq ''){
+	  # empty line, only occurs after a context has finished and before a new context starts
+	  next;
+	}
+
+	my ($pos,$meth,$unmeth) = (split /\t/);
+	# warn "$pos\t$meth\t$unmeth\n"; sleep(1);
+	if ($read eq 'R1'){
+	  $mbias_1{$context}->{$pos}->{meth} += $meth;
+	  $mbias_1{$context}->{$pos}->{un} += $unmeth;
+	}
+	elsif ($read eq 'R2'){
+	  $mbias_2{$context}->{$pos}->{meth} += $meth;
+	  $mbias_2{$context}->{$pos}->{un} += $unmeth;
+	}
+      }
+    }
+    close IR or warn "Had trouble closing filehandle for $file: $!\n";
+  }
+
+  # deleting the individual reports afterwards
+  foreach my $file (@mbias_reports){
+    unlink $file;
+  }
+}
+
+
+sub delete_unused_files{
+
+  warn "Deleting unused files ...\n\n"; sleep(1);
+
+  my $index = 0;
+
+  while ($index <= $#sorting_files){
+    if ($sorting_files[$index] =~ /gz$/){
+      open (USED,"zcat $sorting_files[$index] |") or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n";
+    }
+    else{
+      open (USED,$sorting_files[$index]) or die "Failed to read from methylation extractor output file $sorting_files[$index]: $!\n";
+    }
+
+    my $used = 0;
+
+    while (<USED>){
+      next if (/^Bismark/);
+      if ($_){
+	$used = 1;
+	last;
+      }
+    }
+
+    if ($used){
+      warn "$sorting_files[$index] contains data ->\tkept\n";
+      ++$index;
+    }
+    else{
+
+      my $delete = unlink $sorting_files[$index];
+
+      if ($delete){
+	warn "$sorting_files[$index] was empty ->\tdeleted\n";
+      }
+      else{
+	warn "$sorting_files[$index] was empty, however deletion was unsuccessful: $!\n"
+      }
+
+      ### we also need to remove the element from @sorting_files
+      splice @sorting_files, $index, 1;
+    }
+  }
+  warn "\n\n"; ## can't close the piped filehandles at this point because it will die (unfortunately)
+}
+
+sub produce_mbias_plots{
+
+  my $filename = shift;
+
+  my $mbias = (split (/\//,$filename))[-1]; # extracting the filename if a full path was specified
+  $mbias =~ s/gz$//;
+  $mbias =~ s/sam$//;
+  $mbias =~ s/bam$//;
+  $mbias =~ s/txt$//;
+   my $mbias_graph_1 = my $mbias_graph_2 = $mbias;
+  $mbias_graph_1 = $output_dir . $mbias_graph_1 . 'M-bias_R1.png';
+  $mbias_graph_2 = $output_dir . $mbias_graph_2 . 'M-bias_R2.png';
+
+  $mbias =~ s/$/M-bias.txt/;
+
+  open (MBIAS,'>',"$output_dir$mbias") or die "Failed to open file for the M-bias data\n\n";
+
+  # determining maximum read length
+  my $max_length_1 = 0;
+  my $max_length_2 = 0;
+
+  foreach my $context (keys %mbias_1){
+    foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){
+      $max_length_1 = $pos unless ($max_length_1 >= $pos);
+    }
+  }
+  if ($paired){
+    foreach my $context (keys %mbias_2){
+      foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){
+	$max_length_2 = $pos unless ($max_length_2 >= $pos);
+      }
+    }
+  }
+
+  if ($single){
+    warn "Determining maximum read length for M-Bias plot\n";
+    warn "Maximum read length of Read 1: $max_length_1\n\n";
+  }
+  else{
+    warn "Determining maximum read lengths for M-Bias plots\n";
+    warn "Maximum read length of Read 1: $max_length_1\n";
+    warn "Maximum read length of Read 2: $max_length_2\n\n";
+  }
+  # sleep(3);
+
+  my @mbias_read1;
+  my @mbias_read2;
+
+  #Check whether the module GD::Graph:lines is installed
+  my $gd_graph_installed = 0;
+  eval{
+    require GD::Graph::lines;
+    GD::Graph::lines->import();
+  };
+
+  unless($@) { # syntax or routine error variable, set if something goes wrong in the last eval{ require ...}
+    $gd_graph_installed = 1;
+
+    #Check whether the module GD::Graph::colour is installed
+    eval{
+      require GD::Graph::colour;
+      GD::Graph::colour->import(qw(:colours :lists :files :convert));
+    };
+
+    if ($@) {
+      warn "Perl module GD::Graph::colour not found, skipping drawing M-bias plots (only writing out M-bias plot table)\n";
+      sleep(2);
+      $gd_graph_installed = 0;
+    }
+
+
+  }
+  else{
+    warn "Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table)\n";
+    sleep(2);
+  }
+
+
+  my $graph_title;
+  my $graph1;
+  my $graph2;
+
+  if ( $gd_graph_installed){
+    $graph1 = GD::Graph::lines->new(800,600);
+    if ($paired){
+      $graph2 = GD::Graph::lines->new(800,600);
+    }
+  }
+
+  foreach my $context (qw(CpG CHG CHH)){
+    @{$mbias_read1[0]} = ();
+
+    if ($paired){
+      print MBIAS "$context context (R1)\n================\n";
+      $graph_title = 'M-bias (Read 1)';
+    }
+    else{
+      print MBIAS "$context context\n===========\n";
+      $graph_title = 'M-bias';
+    }
+    print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n";
+
+    foreach my $pos (1..$max_length_1){
+
+      unless (defined $mbias_1{$context}->{$pos}->{meth}){
+	$mbias_1{$context}->{$pos}->{meth} = 0;
+      }
+      unless (defined $mbias_1{$context}->{$pos}->{un}){
+	$mbias_1{$context}->{$pos}->{un} = 0;
+      }
+
+      my $percent = '';
+      if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){
+	$percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) );
+      }
+      my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth};
+
+      print MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n";
+      push @{$mbias_read1[0]},$pos;
+
+      if ($context eq 'CpG'){
+	push @{$mbias_read1[1]},$percent;
+	push @{$mbias_read1[4]},$coverage;
+      }
+      elsif ($context eq 'CHG'){
+	push @{$mbias_read1[2]},$percent;
+	push @{$mbias_read1[5]},$coverage;
+      }
+      elsif ($context eq 'CHH'){
+    	push @{$mbias_read1[3]},$percent;
+	push @{$mbias_read1[6]},$coverage;
+      }
+    }
+    print MBIAS "\n";
+  }
+
+  if ( $gd_graph_installed){
+
+    add_colour(nice_blue => [31,120,180]);
+    add_colour(nice_orange => [255,127,0]);
+    add_colour(nice_green => [51,160,44]);
+    add_colour(pale_blue => [153,206,227]);
+    add_colour(pale_orange => [253,204,138]);
+    add_colour(pale_green => [191,230,207]);
+
+    $graph1->set(
+		 x_label              => 'position (bp)',
+		 y1_label              => '% methylation',
+		 y2_label              => '# methylation calls',
+		 title                => $graph_title,
+		 line_width           => 2,
+		 x_max_value          => $max_length_1,
+		 x_min_value          => 0,
+		 y_tick_number        => 10,
+		 y_label_skip         => 2,
+		 y1_max_value          => 100,
+		 y1_min_value          => 0,
+		 y_label_skip         => 2,
+		 y2_min_value          => 0,
+		 x_label_skip         => 5,
+		 x_label_position     => 0.5,
+		 x_tick_offset        => -1,
+		 bgclr                => 'white',
+		 transparent          => 0,
+		 two_axes             => 1,
+		 use_axis             => [1,1,1,2,2,2],
+		 legend_placement     => 'RC',
+		 legend_spacing       => 6,
+		 legend_marker_width  => 24,
+		 legend_marker_height => 18,
+		 dclrs              => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)],
+		) or die $graph1->error;
+
+    $graph1->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls');
+
+    ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014)
+    if (my $gd1 = $graph1->plot(\@mbias_read1)) {
+      open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n";
+      binmode MBIAS_G1;
+      print MBIAS_G1 $gd1->png;
+    }
+    else {
+      warn "WARNING: Cannot generate read 1 M-bias plot: " , $graph1->error  , "\n\n";
+    }
+
+    #     my $gd1 = $graph1->plot(\@mbias_read1) or die $graph1->error;
+    #     open (MBIAS_G1,'>',$mbias_graph_1) or die "Failed to write to file for M-bias plot 1: $!\n\n";
+    #     binmode MBIAS_G1;
+    #     print MBIAS_G1 $gd1->png;
+  }
+
+  if ($paired){
+
+    foreach my $context (qw(CpG CHG CHH)){
+      @{$mbias_read2[0]} = ();
+
+      print MBIAS "$context context (R2)\n================\n";
+      print MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n";
+      foreach my $pos (1..$max_length_2){
+	
+	unless (defined $mbias_2{$context}->{$pos}->{meth}){
+	  $mbias_2{$context}->{$pos}->{meth} = 0;
+	}
+	unless (defined $mbias_2{$context}->{$pos}->{un}){
+	  $mbias_2{$context}->{$pos}->{un} = 0;
+	}
+
+	my $percent = '';
+	if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){
+	  $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) );
+	}
+	my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth};
+
+	print MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n";
+	
+	push @{$mbias_read2[0]},$pos;
+	
+	if ($context eq 'CpG'){
+	  push @{$mbias_read2[1]},$percent;
+	  push @{$mbias_read2[4]},$coverage;
+	}
+	elsif ($context eq 'CHG'){
+	  push @{$mbias_read2[2]},$percent;
+	  push @{$mbias_read2[5]},$coverage;
+	}
+	elsif ($context eq 'CHH'){
+	  push @{$mbias_read2[3]},$percent;
+	  push @{$mbias_read2[6]},$coverage;
+	}
+      }	
+      print MBIAS "\n";
+    }
+
+    if ( $gd_graph_installed){
+
+      add_colour(nice_blue => [31,120,180]);
+      add_colour(nice_orange => [255,127,0]);
+      add_colour(nice_green => [51,160,44]);
+      add_colour(pale_blue => [153,206,227]);
+      add_colour(pale_orange => [253,204,138]);
+      add_colour(pale_green => [191,230,207]);
+
+      $graph2->set(
+		   x_label              => 'position (bp)',
+		   line_width           => 2,
+		   x_max_value          => $max_length_1,
+		   x_min_value          => 0,
+		   y_tick_number        => 10,
+		   y_label_skip         => 2,
+		   y1_max_value          => 100,
+		   y1_min_value          => 0,
+		   y_label_skip         => 2,
+		   y2_min_value          => 0,
+		   x_label_skip         => 5,
+		   x_label_position     => 0.5,
+		   x_tick_offset        => -1,
+		   bgclr                => 'white',
+		   transparent          => 0,
+		   two_axes             => 1,
+		   use_axis             => [1,1,1,2,2,2],
+		   legend_placement     => 'RC',
+		   legend_spacing       => 6,
+		   legend_marker_width  => 24,
+		   legend_marker_height => 18,
+		   dclrs                => [ qw(nice_blue nice_orange nice_green pale_blue pale_orange pale_green)],
+		   x_label              => 'position (bp)',
+		   y1_label             => '% methylation',
+		   y2_label             => '# calls',
+		   title                => 'M-bias (Read 2)',
+		  ) or die $graph2->error;
+
+      $graph2->set_legend('CpG methylation','CHG methylation','CHH methylation','CpG total calls','CHG total calls','CHH total calls');
+
+      ### Failure to plot the MBIAS graph will now generate a warning instead of dieing (previous version below. Suggested by Andrew DeiRossi, 05 June 2014)
+      if (my $gd2 = $graph2->plot(\@mbias_read2)) {
+        open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n";
+        binmode MBIAS_G2;
+        print MBIAS_G2 $gd2->png;
+      }
+      else {
+        warn "WARNING: Cannot generate Read 2 M-bias plot: " , $graph2->error , "\n\n";
+      }
+
+      # my $gd2 = $graph2->plot(\@mbias_read2) or die $graph2->error;
+      # open (MBIAS_G2,'>',$mbias_graph_2) or die "Failed to write to file for M-bias plot 2: $!\n\n";
+      # binmode MBIAS_G2;
+      # print MBIAS_G2 $gd2->png;
+
+    }
+  }
+}
+
+sub process_commandline{
+  my $help;
+  my $single_end;
+  my $paired_end;
+  my $ignore;
+  my $ignore_r2;
+  my $genomic_fasta;
+  my $full;
+  my $report;
+  my $extractor_version;
+  my $no_overlap;
+  my $merge_non_CpG;
+  my $vanilla;
+  my $output_dir;
+  my $no_header;
+  my $bedGraph;
+  my $coverage_threshold = 1; # Minimum number of reads covering before calling methylation status
+  my $remove;
+  my $counts;
+  my $cytosine_report;
+  my $genome_folder;
+  my $zero;
+  my $CpG_only;
+  my $CX_context;
+  my $split_by_chromosome;
+  my $sort_size;
+  my $samtools_path;
+  my $gzip;
+  my $mbias_only;
+  my $mbias_off;
+  my $gazillion;
+  my $ample_mem;
+  my $include_overlap;
+  my $ignore_3prime;
+  my $ignore_3prime_r2;
+  my $multicore;
+
+  my $command_line = GetOptions ('help|man'             => \$help,
+				 'p|paired-end'         => \$paired_end,
+				 's|single-end'         => \$single_end,
+				 'fasta'                => \$genomic_fasta,
+				 'ignore=i'             => \$ignore,
+				 'ignore_r2=i'          => \$ignore_r2,
+				 'comprehensive'        => \$full,
+				 'report'               => \$report,
+				 'version'              => \$extractor_version,
+				 'no_overlap'           => \$no_overlap,
+				 'merge_non_CpG'        => \$merge_non_CpG,
+				 'vanilla'              => \$vanilla,
+				 'o|output=s'           => \$output_dir,
+				 'no_header'            => \$no_header,
+				 'bedGraph'             => \$bedGraph,
+				 "cutoff=i"             => \$coverage_threshold,
+				 "remove_spaces"        => \$remove,
+				 "counts"               => \$counts,
+				 "cytosine_report"      => \$cytosine_report,
+				 'g|genome_folder=s'    => \$genome_folder,
+				 "zero_based"           => \$zero,	
+				 "CX|CX_context"        => \$CX_context,
+				 "split_by_chromosome"  => \$split_by_chromosome,
+				 "buffer_size=s"        => \$sort_size,
+				 'samtools_path=s'      => \$samtools_path,
+				 'gzip'                 => \$gzip,
+				 'mbias_only'           => \$mbias_only,			
+				 'mbias_off'            => \$mbias_off,			
+				 'gazillion|scaffolds'  => \$gazillion,
+				 'ample_memory'         => \$ample_mem,
+				 'include_overlap'      => \$include_overlap,
+				 'ignore_3prime=i'      => \$ignore_3prime,
+				 'ignore_3prime_r2=i'   => \$ignore_3prime_r2,
+				 'multicore=i'          => \$multicore,
+	);
+
+  ### EXIT ON ERROR if there were errors with any of the supplied options
+  unless ($command_line){
+    die "Please respecify command line options\n";
+  }
+
+  ### HELPFILE
+  if ($help){
+    print_helpfile();
+    exit;
+  }
+
+  if ($extractor_version){
+    print << "VERSION";
+
+
+                           Bismark Methylation Extractor
+
+                         Bismark Extractor Version: $version
+              Copyright 2010-15 Felix Krueger, Babraham Bioinformatics
+                www.bioinformatics.babraham.ac.uk/projects/bismark/
+
+
+VERSION
+    exit;
+  }
+
+
+  ### no files provided
+  unless (@ARGV){
+    die "You need to provide one or more Bismark files to create an individual C methylation output. Please respecify!\n";
+  }
+  @filenames = @ARGV;
+
+  warn "\n *** Bismark methylation extractor version $version ***\n\n";
+
+  ### M-BIAS ONLY
+  if ($mbias_only){
+
+    if ($mbias_off){
+      die "Options '--mbias_only' and '--mbias_off' are not compatible. Just pick one, mkay?\n";
+    }
+    if ($bedGraph){
+      die "Option '--mbias_only' skips all sorts of methylation extraction, including the bedGraph generation. Please respecify!\n";
+    }
+    if ($cytosine_report){
+      die "Option '--mbias_only' skips all sorts of methylation extraction, including the genome-wide cytosine methylation report generation. Please respecify!\n";
+    }
+    if ($merge_non_CpG){
+      warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--merge' won't have any effect\n";
+    }
+    if ($full){
+      warn "Option '--mbias_only' skips all sorts of methylation extraction, thus '--comprehensive' won't have any effect\n";
+    }
+    sleep(3);
+  }
+
+  ### PRINT A REPORT
+  unless ($report){
+    $report = 1; # making this the default
+  }
+
+  ### OUTPUT DIR PATH
+  if ($output_dir){
+    unless ($output_dir =~ /\/$/){
+      $output_dir =~ s/$/\//;
+    }
+  }
+  else{
+    $output_dir = '';
+  }
+
+  ### NO HEADER
+  unless ($no_header){
+    $no_header = 0;
+  }
+
+  ### OLD (VANILLA) OUTPUT FORMAT
+  unless ($vanilla){
+    $vanilla = 0;
+  }
+
+  if ($single_end){
+    $paired_end = 0;   ### SINGLE END ALIGNMENTS
+  }
+  elsif ($paired_end){
+    $single_end = 0;   ### PAIRED-END ALIGNMENTS
+  }
+  else{
+
+    ### we will try to determine whether the input file was a single-end or paired-end sequencing run from the SAM header
+
+    if ($vanilla){
+      die "Please specify whether the supplied file(s) are in Bismark single-end or paired-end format with '-s' or '-p'\n\n";
+    }
+    else{ # SAM/BAM format
+
+      my $file = $filenames[0];
+      warn "Trying to determine the type of mapping from the SAM header line of file $file\n"; sleep(1);
+	
+      ### if the user did not specify whether the alignment file was single-end or paired-end we are trying to get this information from the @PG header line in the SAM/BAM file
+      if ($file =~ /\.gz$/){
+	open (DETERMINE,"zcat $file |") or die "Unable to read from gzipped file $file: $!\n";
+      }
+      elsif ($file =~ /\.bam$/ || isBam($file) ){ ### this would allow to read BAM files that do not end in *.bam
+	open (DETERMINE,"samtools view -h $file |") or die "Unable to read from BAM file $file: $!\n";
+      }
+      else{
+	open (DETERMINE,$file) or die "Unable to read from $file: $!\n";
+      }
+
+      while (<DETERMINE>){
+	last unless (/^\@/);
+	if ($_ =~ /^\@PG/){
+	  # warn "found the \@PG line:\n";
+	  # warn "$_";
+	
+	  if ($_ =~ /\s+-1\s+/ and $_ =~ /\s+-2\s+/){
+	    warn "Treating file(s) as paired-end data (as extracted from \@PG line)\n\n"; sleep(1);
+	    $paired_end = 1;
+	    $single_end = 0;
+	  }
+	  else{
+	    warn "Treating file(s) as single-end data (as extracted from \@PG line)\n\n"; sleep(1);
+	    $paired_end = 0;
+	    $single_end = 1;
+	  }
+	}
+      }
+
+      # close DETERMINE or warn $!; # this always throws an error anyway...
+	
+    }
+  }
+
+  ### IGNORING <INT> 5' END 
+  # bases at the start of the read when processing the methylation call string
+  unless ($ignore){
+    $ignore = 0;
+  }
+
+  if (defined $ignore_r2){
+    die "You can only specify --ignore_r2 for paired-end result files\n" unless ($paired_end);
+  }
+  else{
+    $ignore_r2 = 0;
+  }
+
+  ### IGNORING <INT> 3' END
+  # bases at the end of the read when processing the methylation call string
+  unless ($ignore_3prime){
+    $ignore_3prime = 0;
+  }
+
+  if (defined $ignore_3prime_r2){
+    die "You can only specify --ignore_3prime_r2 for paired-end result files\n" unless ($paired_end);
+  }
+  else{
+    $ignore_3prime_r2 = 0;
+  }
+
+
+  ### NO OVERLAP
+  ### --no_overlap is the default (as of version 0.12.6), unless someone explicitly asks to include overlaps
+  if ($include_overlap){
+    die "The option '--include_overlap' can only be specified for paired-end input!\n" unless ($paired_end);
+    warn "Setting option '--inlcude_overlap' for paired-end data (user-defined)\n\n";
+    $no_overlap = 0;
+  }
+  else{ # default
+    if ($paired_end){
+      warn "Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data\n\n";
+      $no_overlap = 1;
+    }
+  }
+
+  ### COMPREHENSIVE OUTPUT
+  unless ($full){
+    $full = 0;
+  }
+
+  ### MERGE NON-CpG context
+  unless ($merge_non_CpG){
+    $merge_non_CpG = 0;
+  }
+
+  ### remove white spaces in read ID (needed for sorting using the sort command
+  unless ($remove){
+    $remove = 0;
+  }
+
+  ### COVERAGE THRESHOLD FOR bedGraph OUTPUT
+  if (defined $coverage_threshold){
+    unless ($coverage_threshold > 0){
+      die "Please select a coverage greater than 0 (positive integers only)\n";
+    }
+  }
+  else{
+    $coverage_threshold = 1;
+  }
+
+  ### SORT buffer size
+  if (defined $sort_size){
+    unless ($sort_size =~ /^\d+\%$/ or $sort_size =~ /^\d+(K|M|G|T)$/){
+      die "Please select a buffer size as percentage (e.g. --buffer_size 20%) or a number to be multiplied with K, M, G, T etc. (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line\n";
+    }
+  }
+  else{
+    $sort_size = '2G';
+  }
+
+  if ($zero){
+    die "Option '--zero' is only available if  '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph);
+  }
+
+  if ($CX_context){
+    die "Option '--CX_context' is only available if  '--bedGraph' or '--cytosine_report' are specified as well. Please respecify\n" unless ($cytosine_report or $bedGraph);
+  }
+  else{
+    $CX_context = 0;
+  }
+
+  unless ($counts){
+    $counts = 1; # counts will always be set
+  }
+
+  if ($cytosine_report){
+
+    ### GENOME folder
+    if ($genome_folder){
+      unless ($genome_folder =~/\/$/){
+	$genome_folder =~ s/$/\//;
+      }
+    }
+    else{
+      die "Please specify a genome folder to proceed (full path only)\n";
+    }
+
+    unless ($bedGraph){
+      warn "Setting the option '--bedGraph' since this is required for the genome-wide cytosine report\n";
+      $bedGraph = 1;
+    }
+    unless ($counts){
+      # warn "Setting the option '--counts' since this is required for the genome-wide cytosine report\n";
+      $counts = 1;
+    }
+    warn "\n";
+  }
+
+  ### PATH TO SAMTOOLS
+  if (defined $samtools_path){
+    # if Samtools was specified as full command
+    if ($samtools_path =~ /samtools$/){
+      if (-e $samtools_path){
+	# Samtools executable found
+      }
+      else{
+	die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n";
+      }
+    }
+    else{
+      unless ($samtools_path =~ /\/$/){
+	$samtools_path =~ s/$/\//;
+      }
+      $samtools_path .= 'samtools';
+      if (-e $samtools_path){
+	# Samtools executable found
+      }
+      else{
+	die "Could not find an installation of Samtools at the location $samtools_path. Please respecify\n";
+      }
+    }
+  }
+  # Check whether Samtools is in the PATH if no path was supplied by the user
+  else{
+    if (!system "which samtools >/dev/null 2>&1"){ # STDOUT is binned, STDERR is redirected to STDOUT. Returns 0 if Samtools is in the PATH
+      $samtools_path = `which samtools`;
+      chomp $samtools_path;
+    }
+  }
+
+  unless (defined $samtools_path){
+    $samtools_path = '';
+  }
+
+
+  if ($gazillion){
+    if ($ample_mem){
+      die "You can't currently select '--ample_mem' together with '--gazillion'. Make your pick!\n\n";
+    }
+  }
+
+  if (defined $multicore){
+    unless ($multicore > 0){
+      die "Core usage needs to be set to 1 or more (currently selected $multicore). Please respecify!\n";
+    }
+    if ($multicore > 20){
+      warn "Core usage currently set to more than 20 threads. Let's see how this goes... (set value: $multicore)\n\n";
+    }
+  }
+  else{
+    $multicore = 1; # default. Single-thread mode
+    warn "Setting core usage to single-threaded (default). Consider using --multicore <int> to speed up the extraction process.\n\n";
+  }
+
+  return ($ignore,$genomic_fasta,$single_end,$paired_end,$full,$report,$no_overlap,$merge_non_CpG,$vanilla,$output_dir,$no_header,$bedGraph,$remove,$coverage_threshold,$counts,$cytosine_report,$genome_folder,$zero,$CpG_only,$CX_context,$split_by_chromosome,$sort_size,$samtools_path,$gzip,$ignore_r2,$mbias_off,$mbias_only,$gazillion,$ample_mem,$ignore_3prime,$ignore_3prime_r2,$multicore);
+}
+
+
+sub test_positional_sorting{
+
+  my $filename = shift;
+
+  print "\nNow testing Bismark result file $filename for positional sorting (which would be bad...)\t";
+  sleep(1);
+
+  if ($filename =~ /\.gz$/) {
+    open (TEST,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n";
+  }
+  elsif ($filename =~ /bam$/ ||  isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam
+    if ($samtools_path){
+      open (TEST,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n";
+    }
+    else{
+      die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n";
+    }
+  }
+  else {
+    open (TEST,$filename) or die "Can't open file $filename: $!\n";
+  }
+
+  my $count = 0;
+
+  while (<TEST>) {
+    if (/^\@/) {	     # testing header lines if they contain the @SO flag (for being sorted)
+      if (/^\@SO/) {
+	die "SAM/BAM header line '$_' indicates that the Bismark aligment file has been sorted by chromosomal positions which is is incompatible with correct methylation extraction. Please use an unsorted file instead\n\n";
+      }
+      next;
+    }
+    $count++;
+
+    last if ($count > 100000); # else we test the first 100000 sequences if they start with the same read ID
+
+    my ($id_1) = (split (/\t/));
+
+    ### reading the next line which should be read 2
+    $_ = <TEST>;
+    my ($id_2) = (split (/\t/));
+    last unless ($id_2);
+    ++$count;
+
+    if ($id_1 eq $id_2){
+      ### ids are the same
+      next;
+    }
+    else{ ### in previous versions of Bismark we appended /1 and /2 to the read IDs for easier eyeballing which read is which. These tags need to be removed first
+      my $id_1_trunc = $id_1;
+      $id_1_trunc =~ s/\/1$//;
+      my $id_2_trunc = $id_2;
+      $id_2_trunc =~ s/\/2$//;
+
+      unless ($id_1_trunc eq $id_2_trunc){
+	die "The IDs of Read 1 ($id_1) and Read 2 ($id_2) are not the same. This might be a result of sorting the paired-end SAM/BAM files by chromosomal position which is not compatible with correct methylation extraction. Please use an unsorted file instead\n\n";
+      }
+    }
+  }
+  #  close TEST or die $!; somehow fails on our cluster...
+  ### If it hasen't died so far then it seems the file is in the correct Bismark format (read 1 and read 2 of a pair directly following each other)
+  warn "...passed!\n";
+  sleep(1);
+
+}
+
+sub process_Bismark_results_file{
+
+  my $filename = shift;
+  my $report_filename = open_output_filehandles($filename);
+
+  ### disabling buffering so we don't run into problems with half written out lines...
+  foreach my $fh (keys %fhs){
+    if ($fh =~ /^[1230]$/) {
+      foreach my $context (keys %{$fhs{$fh}}) {
+	select($fhs{$fh}->{$context});
+	$|++;
+      }
+    }
+    else{
+      select($fhs{$fh});
+      $|++;
+    }
+  }
+  select(STDOUT);
+
+  ################################################
+  ################################################
+  ### multi-process handling
+  ###
+
+  my $offset = 1;
+  my $process_id;
+  my @pids;
+  if ($multicore > 1){
+
+    until ($offset == $multicore){
+      # warn "multicore: $multicore\noffset: $offset\n";
+      my $fork = fork;
+
+      if (defined $fork){
+	if ($fork != 0){
+	  $process_id = $fork;
+	  push @pids, $process_id;
+	  if ($offset < $multicore){
+	    ++$offset;
+	    # warn "I am the parent process, child pid: $fork\nIncrementing offset counter to: $offset\n\n";
+	  }
+	  else{
+	    # warn "Reached the number of maximum multicores. Proceeeding to processing...\n";
+	  }
+	}
+	elsif ($fork == 0){
+	  # warn "I am a child process, pid: $fork\nOffset counter is: $offset\nProceeding to processing...\n";
+	  $process_id = $fork;
+	  last;
+	}
+      }
+      else{
+	die "Forking unsuccessful. Proceeding using a single thread only\n";
+      }
+    }
+
+    # warn "\nThe thread identity\n===================\n";
+    if ($process_id){
+      # print "I am the parent process. My children are called:\n";
+      # print join ("\t",@pids),"\n";
+      # print "I am going to process the following line count: $offset\n\n";
+    }
+    elsif($process_id == 0){
+      # warn "I am a child process: Process ID: $process_id\n";
+      # warn "I am going to process the following line count: $offset\n\n";
+    }
+    else{
+      die "Process ID was: $process_id\n";
+    }
+  }
+  else{
+    # warn "Single-core mode: setting pid to 1\n";
+    $process_id = 1;
+  }
+
+  ################################################
+  ################################################
+  if ($process_id){
+    warn "Now reading in Bismark result file $filename\n";
+  }
+  else{
+    warn "\nNow reading in Bismark result file $filename\n\n";
+  }
+
+  if ($filename =~ /\.gz$/) {
+    open (IN,"zcat $filename |") or die "Can't open gzipped file $filename: $!\n";
+  }
+  elsif ($filename =~ /bam$/ || isBam($filename) ){ ### this would allow to read BAM files that do not end in *.bam
+    if ($samtools_path){
+      open (IN,"$samtools_path view -h $filename |") or die "Can't open BAM file $filename: $!\n";
+    }
+    else{
+      die "Sorry couldn't find an installation of Samtools. Either specifiy an alternative path using the option '--samtools_path /your/path/', or use a SAM file instead\n\n";
+    }
+  }
+  else {
+    open (IN,$filename) or die "Can't open file $filename: $!\n";
+  }
+
+  ### Vanilla and SAM output need to read different numbers of header lines
+  if ($vanilla) {
+    my $bismark_version = <IN>; ## discarding the Bismark version info
+    chomp $bismark_version;
+    $bismark_version =~ s/\r//; # replaces \r line feed
+    $bismark_version =~  s/Bismark version: //;
+    if ($bismark_version =~ /^\@/) {
+      warn "Detected \@ as the first character of the version information. Is it possible that the file is in SAM format?\n\n";
+      sleep (1);
+    }
+
+    unless ($version eq $bismark_version){
+      die "The methylation extractor and Bismark itself need to be of the same version!\n\nVersions used:\nmethylation extractor: '$version'\nBismark: '$bismark_version'\n";
+    }
+  } else {
+    # If the read is in SAM format (default) it can either start with @ header lines or start with alignments directly.
+    # We are reading from it further down
+  }
+
+  my $methylation_call_strings_processed = 0;
+  my $line_count = 0;
+
+  ### proceeding differently now for single-end or paired-end Bismark files
+
+  ### PROCESSING SINGLE-END RESULT FILES
+  if ($single) {
+
+    ### also proceeding differently now for SAM format or vanilla Bismark format files
+    if ($vanilla) {		# old vanilla Bismark output format
+      while (<IN>) {
+	++$line_count;
+	warn "Processed lines: $line_count\n" if ($line_count%500000==0);
+
+	if ( ($line_count - $offset)%$multicore == 0){
+	  # warn "line count: $line_count\noffset: $offset\n";
+	  # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
+	  # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
+	}
+	else{
+	  # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
+	  next;
+	}
+	
+	### $seq here is the chromosomal sequence (to use for the repeat analysis for example)
+	my ($id,$strand,$chrom,$start,$seq,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,6,7,8,9];
+	
+	### we need to remove 2 bp of the genomic sequence as we were extracting read + 2bp long fragments to make a methylation call at the first or
+	### last position
+	chomp $genome_conversion;
+
+	my $index;
+	if ($meth_call) {
+
+	  if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand
+	    $index = 0;
+	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand
+	    $index = 1;
+	  } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand
+	    $index = 3;
+	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand
+	    $index = 2;
+	  } else {
+	    die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n";
+	  }
+	
+	  ### Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int>
+	  if ($ignore) {
+	    $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore);	
+	
+	    ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly!
+	    if ($strand eq '+') {
+	      $start += $ignore;
+	    }
+	    elsif ($strand eq '-') {
+	      $start += length($meth_call)-1; ## $meth_call is already shortened!
+	    }
+	    else {
+	      die "Alignment did not have proper strand information: $strand\n";
+	    }
+	  }
+	
+	  ### Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int>
+	  if ($ignore_3prime) {
+	
+	    $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime);	
+	
+	    ### If we are clipping off some bases at the end we need to adjust the end position of the alignments accordingly
+	    if ($strand eq '+') {
+	      # clipping the 3' end does not affect the starting position # ignore 5' has already been taken care of, if relevant at all
+	    }
+	    elsif ($strand eq '-') {
+	      # here we need to discriminate if the start has been adjusted because of --ignore or not
+	      if ($ignore){
+		# position adjusted already, and because of this 3' trimming is irrelevant for the start position
+	      }
+	      else{
+		# Here we need to add the length ignore_3prime to the read starting position, adjustment of the start position will take place later in the methylation extraction step
+		$start += $ignore_3prime;
+	      }
+	    }
+	    else {
+	      die "Alignment did not have proper strand information: $strand\n";
+	    }
+	  }
+	  ### just as a comment, if --ignore has not been specified the starting position of reverse reads is adjusted later at the methylation extraction stage
+	
+	  ### printing out the methylation state of every C in the read
+	  print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index);
+	
+	  ++$methylation_call_strings_processed; # 1 per single-end result
+	}
+      }
+    } else {		  # processing single-end SAM format (default)
+      while (<IN>) {
+	chomp;
+	### SAM format can either start with header lines (starting with @) or start with alignments directly
+	if (/^\@/) {	     # skipping header lines (starting with @)
+	  warn "skipping SAM header line:\t$_\n" unless ($process_id == 0);
+	  next;
+	}
+
+	++$line_count;
+	#	warn "$line_count\n";
+	warn "Processed lines: $line_count\n" if ($line_count%500000 == 0);
+
+	if ( ($line_count - $offset)%$multicore == 0){
+	  # warn "line count: $line_count\noffset: $offset\n";
+	  # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
+	  # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
+	}
+	else{
+	  # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
+	  next;
+	}
+	
+	# example read in SAM format
+	# 1_R1/1	67	5	103172224	255	40M	=	103172417	233	AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:4	XX:Z:4T1T24TT7	XM:Z:....h.h........................hh.......	XR:Z:CT	XG:Z:CT
+	###
+
+	# < 0.7.6 my ($id,$chrom,$start,$meth_call,$read_conversion,$genome_conversion) = (split("\t"))[0,2,3,13,14,15];
+	# < 0.7.6 $meth_call =~ s/^XM:Z://;
+	# < 0.7.6 $read_conversion =~ s/^XR:Z://;
+	# < 0.7.6 $genome_conversion =~ s/^XG:Z://;	
+
+	my ($id,$chrom,$start,$cigar) = (split("\t"))[0,2,3,5];
+
+	### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression
+	my $meth_call;	  ### Thanks to Zachary Zeno for this solution
+	my $read_conversion;
+	my $genome_conversion;
+	
+	while ( /(XM|XR|XG):Z:([^\t]+)/g ) {
+	  my $tag = $1;
+	  my $value = $2;
+
+	  if ($tag eq "XM") {
+	    $meth_call = $value;
+	    $meth_call =~ s/\r//;
+	  } elsif ($tag eq "XR") {
+	    $read_conversion = $value;
+	    $read_conversion =~ s/\r//;
+	  } elsif ($tag eq "XG") {
+	    $genome_conversion = $value;
+	    $genome_conversion =~ s/\r//;
+	  }
+	}
+
+	my $strand;
+	# warn "$meth_call\n$read_conversion\n$genome_conversion\n";
+	
+	my $index;
+	if ($meth_call) {
+	  if ($read_conversion eq 'CT' and $genome_conversion eq 'CT') { ## original top strand
+	    $index = 0;
+	    $strand = '+';
+	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'CT') { ## complementary to original top strand
+	    $index = 1;
+	    $strand = '-';
+	  } elsif ($read_conversion eq 'GA' and $genome_conversion eq 'GA') { ## complementary to original bottom strand
+	    $index = 2;
+	    $strand = '+';
+	  } elsif ($read_conversion eq 'CT' and $genome_conversion eq 'GA') { ## original bottom strand
+	    $index = 3;
+	    $strand = '-';
+	  } else {
+	    die "Unexpected combination of read and genome conversion: '$read_conversion' / '$genome_conversion'\n";
+	  }
+	
+	  ### If the read is in SAM format we need to reverse the methylation call if the read has been reverse-complemented for the output
+	  if ($strand eq '-') {
+	    $meth_call = reverse $meth_call;
+	  }
+	  # warn "\n$meth_call\n";
+	
+	  ### IGNORE 5 PRIME: Clipping off the first <int> number of bases from the methylation call string as specified with --ignore <int>
+	  if ($ignore) {
+	    # warn "\n\n$meth_call\n";
+	    $meth_call = substr($meth_call,$ignore,length($meth_call)-$ignore);	
+	    # warn "$meth_call\n";sleep(1);
+
+	    ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly
+
+	    my @len = split (/\D+/,$cigar); # storing the length per operation
+	    my @ops = split (/\d+/,$cigar); # storing the operation
+	    shift @ops;		# remove the empty first element
+	    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
+		
+	    my @comp_cigar; # building an array with all CIGAR operations
+	    foreach my $index (0..$#len) {
+	      foreach (1..$len[$index]) {
+		# print  "$ops[$index]";
+		push @comp_cigar, $ops[$index];
+	      }
+	    }
+	    # print "original CIGAR: $cigar\n";
+	    # print "original CIGAR: @comp_cigar\n";
+
+	    ### If we are clipping off some bases at the start we need to adjust the start position of the alignments accordingly!
+	    if ($strand eq '+') {
+	
+	      my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions
+	      my $I_count = 0;
+
+	      for (1..$ignore) {
+		my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations from the start
+		# print "$_ deleted $op\n";
+
+		while ($op eq 'D') { # repeating this for deletions (D)
+		  $D_count++;
+		  $op = shift @comp_cigar;
+		  # print "$_ deleted $op\n";
+		}
+		if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		  $I_count++;
+		}
+	      }
+	      $start += $ignore + $D_count - $I_count;
+	      # print "start $start\t ignore: $ignore\t D count: $D_count I_count: $I_count\n";
+	    }
+	    elsif ($strand eq '-') {
+
+	      for (1..$ignore) {
+		my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
+		while ($op eq 'D') { # repeating this for deletions (D)
+		  $op = pop @comp_cigar;
+		}
+	      }
+
+	      ### For reverse strand alignments we need to determine the number of matching bases (M) or deletions (D) in the read from the CIGAR
+	      ### string to be able to work out the starting position of the read which is on the 3' end of the sequence
+	      my $MD_count = 0;	# counting all operations that affect the genomic position, i.e. M and D. Insertions do not affect the start position
+	      foreach (@comp_cigar) {
+		++$MD_count if ($_ eq 'M' or $_ eq 'D');
+	      }
+	      $start += $MD_count - 1;
+	    }
+	
+	    ### reconstituting shortened CIGAR string
+	    my $new_cigar;
+	    my $count = 0;
+	    my $last_op;
+	    # print "ignore adjusted: @comp_cigar\n";
+	    foreach my $op (@comp_cigar) {
+	      unless (defined $last_op){
+		$last_op = $op;
+		++$count;
+		next;
+	      }
+	      if ($last_op eq $op) {
+		++$count;
+	      } else {
+		$new_cigar .= "$count$last_op";
+		$last_op = $op;
+		$count = 1;
+	      }
+	    }
+	    $new_cigar .= "$count$last_op"; # appending the last operation and count
+	    $cigar = $new_cigar;
+	    # print "ignore adjusted scalar: $cigar\n";
+	  }
+
+	  #######################
+	  ###  INGORE 3' END  ###
+	  #######################
+	
+	  # Clipping off the last <int> number of bases from the methylation call string as specified with --ignore_3prime <int>
+	  if ($ignore_3prime) {
+	    # warn "$meth_call\n";
+	    $meth_call = substr($meth_call,0, (length($meth_call)) - $ignore_3prime);	
+	    # warn "$meth_call\n";sleep(1);
+	
+	    ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly
+
+	    my @len = split (/\D+/,$cigar); # storing the length per operation
+	    my @ops = split (/\d+/,$cigar); # storing the operation
+	    shift @ops;		# remove the empty first element
+	    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
+		
+	    my @comp_cigar; # building an array with all CIGAR operations
+	    foreach my $index (0..$#len) {
+	      foreach (1..$len[$index]) {
+		# print  "$ops[$index]";
+		push @comp_cigar, $ops[$index];
+	      }
+	    }
+
+	    # print "original CIGAR: $cigar\n";
+	    # print join ("",@comp_cigar),"\n";
+
+	    ### If we are clipping off some bases at the end we might have to adjust the start position of the alignments accordingly
+	    if ($strand eq '+') {
+
+	      ### clipping the 3' end does not affect the starting position of forward strand alignments
+	      # ignore 5' has already been taken care of at this stage, if relevant at all
+	
+	      for (1..$ignore_3prime) {
+		my $op = pop @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations from the end
+		# print join ("",@comp_cigar),"\n";
+		# print "$_ deleted $op from 3' end\n";
+		while ($op eq 'D') { # repeating this for deletions (D)
+		  $op = pop @comp_cigar;
+		  # print join ("",@comp_cigar),"\n";
+		  # print "$_ deleted $op from 3' end\n";
+		}
+	      }
+	      # print "Final truncated CIGAR string:\n";
+	      # print join ("",@comp_cigar),"\n";
+	      # $start += $ignore + $D_count - $I_count;
+	      # print "start $start\t ignore_3prime: $ignore_3prime\t D count: $D_count I_count: $I_count\n";
+	    }
+	    elsif ($strand eq '-') {
+
+	      my $D_count = 0; # counting all deletions that affect the ignored genomic position, i.e. Deletions and insertions
+	      my $I_count = 0;
+	
+	      for (1..$ignore_3prime) {
+		my $op = shift @comp_cigar; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array
+		while ($op eq 'D') { # repeating this for deletions (D)
+		  $D_count++;
+		  $op = shift @comp_cigar;
+		}
+		if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		  $I_count++;
+		}
+	
+	      }
+	
+	      # here we need to discriminate if the start has been adjusted because of --ignore or not
+	      if ($ignore){
+		# the start position has already been modified for --ignore already, so we don't have to adjust the position again now
+	      }
+	      else{
+		# Here we need to add the length ignore_3prime to the read starting position
+		#  adjustment of the true starting position of this reverse read will take place later in the methylation extraction step
+		$start += $ignore_3prime + $D_count - $I_count;
+	      }
+	
+	    }
+	
+	    ### reconstituting shortened CIGAR string
+	    my $new_cigar;
+	    my $count = 0;
+	    my $last_op;
+	    # print "ignore_3prime adjusted:\n"; print join ("",@comp_cigar),"\n";
+	    foreach my $op (@comp_cigar) {
+	      unless (defined $last_op){
+		$last_op = $op;
+		++$count;
+		next;
+	      }
+	      if ($last_op eq $op) {
+		++$count;
+	      } else {
+		$new_cigar .= "$count$last_op";
+		$last_op = $op;
+		$count = 1;
+	      }
+	    }
+	    $new_cigar .= "$count$last_op"; # appending the last operation and count
+	    $cigar = $new_cigar;
+	    # print "ignore_3prime adjusted scalar: $cigar\n";
+	  }
+	}
+	### printing out the methylation state of every C in the read
+	print_individual_C_methylation_states_single_end($meth_call,$chrom,$start,$id,$strand,$index,$cigar);
+	
+	++$methylation_call_strings_processed; # 1 per single-end result
+      }
+    }
+  }
+
+  ### PROCESSING PAIRED-END RESULT FILES
+  elsif ($paired) {
+
+    ### proceeding differently now for SAM format or vanilla Bismark format files
+    if ($vanilla) {	# old vanilla Bismark paired-end output format
+      while (<IN>) {
+	++$line_count;
+	warn "processed line: $line_count\n" if ($line_count%500000 == 0);
+
+	if ( ($line_count - $offset)%$multicore == 0){
+	  # warn "line count: $line_count\noffset: $offset\n";
+	  # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
+	  # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
+	}
+	else{
+	  # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
+	  next;
+	}
+
+	### $seq here is the chromosomal sequence (to use for the repeat analysis for example)
+	my ($id,$strand,$chrom,$start_read_1,$end_read_2,$seq_1,$meth_call_1,$seq_2,$meth_call_2,$first_read_conversion,$genome_conversion) = (split("\t"))[0,1,2,3,4,6,7,9,10,11,12,13];
+
+	my $index;
+	chomp $genome_conversion;
+	
+	if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') {
+	  $index = 0;		## this is OT
+	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') {
+	  $index = 2;		## this is CTOB!!!
+	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') {
+	  $index = 1;		## this is CTOT!!!
+	} elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') {
+	  $index = 3;		## this is OB
+	} else {
+	  die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n";
+	}
+	
+	if ($meth_call_1 and $meth_call_2) {
+	  ### Clipping off the first <int> number of bases from the methylation call strings as specified with '--ignore <int>'
+
+	  ### IGNORE FROM 5' END
+	  if ($ignore) {
+	    $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore);
+	
+	    ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore' was specified
+	    $start_read_1 += $ignore;
+	  }
+	  if ($ignore_r2) {
+	    $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2);
+	
+	    ### we also need to adjust the start and end positions of the alignments accordingly if '--ignore_r2' was specified
+	    $end_read_2   -= $ignore_r2;
+	  }
+
+	  ### IGNORE 3' END
+
+	  ### Clipping off the last <int> number of bases from the methylation call string of Read 1 as specified with --ignore_3prime <int>
+	  if ($ignore_3prime) {
+	    $meth_call_1 = substr($meth_call_1,0, length($meth_call_1) - $ignore_3prime);
+	    # we don't have to adjust the position now since the shortened methylation call will be fine, see below
+	  }
+	  ### Clipping off the last <int> number of bases from the methylation call string of Read 2 as specified with --ignore_3prime_r2 <int>
+	  if ($ignore_3prime_r2) {
+	    $meth_call_2 = substr($meth_call_2,0, length($meth_call_2) - $ignore_3prime_r2);
+	    # we don't have to adjust the position now since the shortened methylation call will be fine, see below
+	  }
+
+	  my $end_read_1;
+	  my $start_read_2;
+
+	  if ($strand eq '+') {
+
+	    $end_read_1 = $start_read_1 + length($meth_call_1) - 1;
+	    $start_read_2 = $end_read_2 - length($meth_call_2) + 1;
+	
+	    ## we first pass the first read which is in + orientation on the forward strand
+	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id,'+',$index,0,0,undef,1); # the last two values are CIGAR string and read identity
+	
+	    # we next pass the second read which is in - orientation on the reverse strand
+	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2
+	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$end_read_2,$id,'-',$index,$no_overlap,$end_read_1,undef,2);
+	  }
+	  else {
+	
+	    $end_read_1 = $start_read_1+length($meth_call_2)-1;	# read 1 is the second reported read!
+	    $start_read_2 = $end_read_2-length($meth_call_1)+1;	# read 2 is the first reported read!
+
+	    ## we first pass the first read which is in - orientation on the reverse strand
+	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$end_read_2,$id,'-',$index,0,0,undef,1);
+
+	    # we next pass the second read which is in + orientation on the forward strand
+	    ### if --no_overlap was specified we also pass the end of read 2. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2
+	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_1,$id,'+',$index,$no_overlap,$start_read_2,undef,2);
+	  }
+	
+	  $methylation_call_strings_processed += 2; # paired-end = 2 methylation calls
+	}	
+      }
+    }
+    else {	      # Bismark paired-end BAM/SAM output format (default)
+      while (<IN>) {
+	chomp;
+	### SAM format can either start with header lines (starting with @) or start with alignments directly
+	if (/^\@/) {	     # skipping header lines (starting with @)
+	  warn "skipping SAM header line:\t$_\n" unless ($process_id == 0); # no additional warnings for child procesess
+	  next;
+	}
+	
+	++$line_count;
+	warn "Processed lines: $line_count\n" if ($line_count%500000==0);
+	
+	if ( ($line_count - $offset)%$multicore == 0){
+	  # warn "line count: $line_count\noffset: $offset\n";
+	  # warn "Modulus: ",($line_count - $offset)%$multicore,"\n";
+	  # warn "processing this line $line_count (processID: $process_id with \$offset $offset)\n";
+	}
+	else{
+	  # warn "skipping line $line_count for processID: $process_id with \$offset $offset)\n";
+	  $_ = <IN>; # reading and skipping another line since this is the paired-end read
+	  next;
+	}
+
+	# example paired-end reads in SAM format (2 consecutive lines)
+	# 1_R1/1	67	5	103172224	255	40M	=	103172417	233	AATATTTTTTTTATTTTAAAATGTGTATTGATTTAAATTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:4	XX:Z:4T1T24TT7	XM:Z:....h.h........................hh.......	XR:Z:CT	XG:Z:CT
+	# 1_R1/2	131	5	103172417	255	40M	=	103172224	-233	TATTTTTTTTTAGAGTATTTTTTAATGGTTATTAGATTTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	NM:i:6	XX:Z:T5T1T9T9T7T3	XM:Z:h.....h.h.........h.........h.......h...	XR:Z:GA	XG:Z:CT
+	
+	my ($id_1,$chrom,$start_read_1,$cigar_1) = (split("\t"))[0,2,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression
+	my $meth_call_1;
+	my $first_read_conversion;
+	my $genome_conversion;
+	
+	while ( /(XM|XR|XG):Z:([^\t]+)/g ) {
+	  my $tag = $1;
+	  my $value = $2;
+
+	  if ($tag eq "XM") {
+	    $meth_call_1 = $value;
+	    $meth_call_1 =~ s/\r//;
+	  } elsif ($tag eq "XR") {
+	    $first_read_conversion = $value;
+	    $first_read_conversion =~ s/\r//;
+	  } elsif ($tag eq "XG") {
+	    $genome_conversion = $value;
+	    $genome_conversion =~ s/\r//;
+	  }
+	}
+
+	$_ = <IN>;		# reading in the paired read
+	chomp;
+	
+	my ($id_2,$start_read_2,$cigar_2) = (split("\t"))[0,3,5]; ### detecting the following SAM flags in case the SAM entry was shuffled by CRAM or Goby compression/decompression
+
+	my $meth_call_2;
+	my $second_read_conversion;
+	
+	while ( /(XM|XR):Z:([^\t]+)/g ) {
+	  my $tag = $1;
+	  my $value = $2;
+
+	  if ($tag eq "XM") {
+	    $meth_call_2 = $value;
+	    $meth_call_2 =~ s/\r//;
+	  } elsif ($tag eq "XR") {
+	    $second_read_conversion = $value;
+	    $second_read_conversion = s/\r//;
+	  }
+	}
+	
+	# < version 0.7.6 $genome_conversion =~ s/^XG:Z://;	
+	# chomp $genome_conversion; # in case it captured a new line character	# already removed
+
+	# print join ("\t",$meth_call_1,$meth_call_2,$first_read_conversion,$second_read_conversion,$genome_conversion),"\n";
+
+	my $index;
+	my $strand;
+
+	if ($first_read_conversion eq 'CT' and $genome_conversion eq 'CT') {
+	  $index = 0;		## this is OT
+	  $strand = '+';
+	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'CT') {
+	  $index = 1;		## this is CTOT
+	  $strand = '-';
+	} elsif ($first_read_conversion eq 'GA' and $genome_conversion eq 'GA') {
+	  $index = 2;		## this is CTOB
+	  $strand = '+';
+	} elsif ($first_read_conversion eq 'CT' and $genome_conversion eq 'GA') {
+	  $index = 3;		## this is OB
+	  $strand = '-';
+	} else {
+	  die "Unexpected combination of read and genome conversion: $first_read_conversion / $genome_conversion\n";
+	}
+
+	### reversing the methylation call of the read that was reverse-complemented
+	if ($strand eq '+') {
+	  $meth_call_2 = reverse $meth_call_2;
+	} else {
+	  $meth_call_1 = reverse $meth_call_1;
+	}
+	# warn "\n$meth_call_1\n$meth_call_2\n";
+
+	if ($meth_call_1 and $meth_call_2) {
+
+	  my $end_read_1;
+	
+	  ### READ 1
+	  my @len_1 = split (/\D+/,$cigar_1); # storing the length per operation
+	  my @ops_1 = split (/\d+/,$cigar_1); # storing the operation
+	  shift @ops_1;		# remove the empty first element
+
+	  die "CIGAR string contained a non-matching number of lengths and operations: $cigar_1\n".join(" ",@len_1)."\n".join(" ",@ops_1)."\n" unless (scalar @len_1 == scalar @ops_1);
+	
+	  my @comp_cigar_1; # building an array with all CIGAR operations
+	  foreach my $index (0..$#len_1) {
+	    foreach (1..$len_1[$index]) {
+	      # print  "$ops_1[$index]";
+	      push @comp_cigar_1, $ops_1[$index];
+	    }
+	  }
+	  # print "original CIGAR read 1: $cigar_1\n";
+	  # print "original CIGAR read 1: @comp_cigar_1\n";
+
+	  ### READ 2
+	  my @len_2 = split (/\D+/,$cigar_2); # storing the length per operation
+	  my @ops_2 = split (/\d+/,$cigar_2); # storing the operation
+	  shift @ops_2;		# remove the empty first element
+	  die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len_2 == scalar @ops_2);
+	  my @comp_cigar_2; # building an array with all CIGAR operations for read 2
+	  foreach my $index (0..$#len_2) {
+	    foreach (1..$len_2[$index]) {
+	      # print  "$ops_2[$index]";
+	      push @comp_cigar_2, $ops_2[$index];
+	    }
+	  }
+	  # print "original CIGAR read 2: $cigar_2\n";
+	  # print "original CIGAR read 2: @comp_cigar_2\n";
+	
+	  ##################################	
+	  ###  IGNORE BASES FROM 5' END  ###
+	  ##################################
+
+	  if ($ignore) {
+	    ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore <int>' for read 1	
+	    ### the methylation calls have already been reversed where necessary
+
+	    if ( (length($meth_call_1) - $ignore) <= 0){
+	      # next; # skipping this read entirely if the read is shorter than the portion to be ignored
+	      $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored
+	    }
+	    else {
+	      $meth_call_1 = substr($meth_call_1,$ignore,length($meth_call_1)-$ignore);
+	
+	      if ($strand eq '+') {
+		
+		### if the (read 1) strand information is '+', read 1 needs to be trimmed from the start
+		my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions
+		my $I_count_1 = 0;
+		
+		for (1..$ignore) {
+		  my $op = shift @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore operations from the start
+		  # print "$_ deleted $op\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $D_count_1++;
+		    $op = shift @comp_cigar_1;
+		    # print "$_ deleted $op\n";
+		  }
+		  if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		    $I_count_1++;
+		  }
+		}
+		
+		$start_read_1 += $ignore + $D_count_1 - $I_count_1;
+		# print "start read 1 $start_read_1\t ignore: $ignore\t D count 1: $D_count_1\tI_count 1: $I_count_1\n";
+
+		# the start position of reads mapping to the reverse strand is being adjusted further below
+	      }
+	      elsif ($strand eq '-') {
+		
+		### if the (read 1) strand information is '-', read 1 needs to be trimmed from the back
+		for (1..$ignore) {
+		  my $op = pop @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $op = pop @comp_cigar_1;
+		  }
+		}
+		# the start position of reads mapping to the reverse strand is being adjusted further below
+		
+	      }
+	    }
+	  }
+	
+	  if ($ignore_r2) {
+	    ### Clipping off the first <int> number of bases from the methylation call string as specified with '--ignore_r2 <int>' for read 2	
+	    ### the methylation calls have already been reversed where necessary
+
+	    if ( (length($meth_call_2) - $ignore_r2) <= 0){
+	      # next; # skipping this read entirely if the read is shorter than the portion to be ignored # this would skip the entire read pair!
+	      $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored
+	    }
+	    else {
+	      $meth_call_2 = substr($meth_call_2,$ignore_r2,length($meth_call_2)-$ignore_r2);
+	
+	      ### If we are ignoring a part of the sequence we also need to adjust the cigar string accordingly
+	
+	      if ($strand eq '+') {
+		
+		### if the (read 1) strand information is '+', read 2 needs to be trimmed from the back
+
+		for (1..$ignore_r2) {
+		  my $op = pop @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the last value of the array
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $op = pop @comp_cigar_2;
+		  }
+		}
+		# the start position of reads mapping to the reverse strand is being adjusted further below
+	      }
+	      elsif ($strand eq '-') {
+	
+		### if the (read 1) strand information is '-', read 2 needs to be trimmed from the start
+		my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions
+		my $I_count_2 = 0;
+
+		for (1..$ignore_r2) {
+		  my $op = shift @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start
+		  # print "$_ deleted $op\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $D_count_2++;
+		    $op = shift @comp_cigar_2;
+		    # print "$_ deleted $op\n";
+		  }
+		  if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		    $I_count_2++;
+		  }
+		}
+		
+		$start_read_2 += $ignore_r2 + $D_count_2 - $I_count_2;
+		# print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n";
+	      }
+	    }
+	  }
+	
+	  if ($ignore and $meth_call_1){ # if the methylation call string is undefined at this position we don't need any new CIGAR string
+	
+	    ### reconstituting shortened CIGAR string 1
+	    my $new_cigar_1;
+	    my $count_1 = 0;
+	    my $last_op_1;
+	    # print "ignore adjusted CIGAR 1: @comp_cigar_1\n";
+	    foreach my $op (@comp_cigar_1) {
+	      unless (defined $last_op_1){
+		$last_op_1 = $op;
+		++$count_1;
+		next;
+	      }
+	      if ($last_op_1 eq $op) {
+		++$count_1;
+	      } else {
+		$new_cigar_1 .= "$count_1$last_op_1";
+		$last_op_1 = $op;
+		$count_1 = 1;
+	      }
+	    }
+	    $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count
+	    $cigar_1 = $new_cigar_1;
+	    # print "ignore adjusted CIGAR 1 scalar: $cigar_1\n";
+	  }
+
+	  if ($ignore_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string
+
+	    ### reconstituting shortened CIGAR string 2
+	    my $new_cigar_2;
+	    my $count_2 = 0;
+	    my $last_op_2;
+	    # print "ignore adjusted CIGAR 2: @comp_cigar_2\n";
+	    foreach my $op (@comp_cigar_2) {
+	      unless (defined $last_op_2){
+		$last_op_2 = $op;
+		++$count_2;
+		next;
+	      }
+	      if ($last_op_2 eq $op) {
+		++$count_2;
+	      }
+	      else {
+		$new_cigar_2 .= "$count_2$last_op_2";
+		$last_op_2 = $op;
+		$count_2 = 1;
+	      }
+	    }
+	    $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count
+	    $cigar_2 = $new_cigar_2;
+	    # print "ignore_r2 adjusted CIGAR 2 scalar: $cigar_2\n";
+	  }
+
+	  ###########################
+	  ###  END IGNORE 5' END  ###
+	  ###########################
+
+	  ##################################
+	  ###  IGNORE BASES FROM 3' END  ###
+	  ##################################
+
+	  # print "CIGAR string before truncating 3' end (Read 1)\n";
+	  # print join ("",@comp_cigar_1),"\n";
+		
+	  if ($ignore_3prime and $meth_call_1) { # if the methylation call string is undefined at this point we don't need to process the read any further
+
+	    ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime <int>' for read 1	
+	    ### the methylation calls have already been reversed where necessary
+
+	    if ( (length($meth_call_1) - $ignore_3prime) <= 0){
+	      $meth_call_1 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored
+	    }
+	    else {
+	      $meth_call_1 = substr($meth_call_1,0,length($meth_call_1) - $ignore_3prime);
+	      # warn "truncated meth_call 1:\n$meth_call_1\n";
+	
+	      if ($strand eq '+') {
+
+		### if the (read 1) strand information is '+', clipping the 3' end does not affect the starting position of forward strand alignments
+		# ignore 5' has already been taken care of at this stage, if relevant at all
+		
+		for (1..$ignore_3prime) {
+		  my $op = pop @comp_cigar_1; # adjusting composite CIGAR string of read 1 by removing $ignore_3prime operations from the end
+		  # print "$_ deleted $op from 3' end\n";
+		  # print join ("",@comp_cigar_1),"\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $op = pop @comp_cigar_1;
+		    # print join ("",@comp_cigar_1),"\n";
+		    # print "$_ deleted $op from 3' end\n";
+		  }
+		}
+		
+		# print "Final truncated CIGAR string (Read 1):\n";
+		# print join ("",@comp_cigar_1),"\n";
+		
+	      }
+	      elsif ($strand eq '-') {
+
+		my $D_count_1 = 0; # counting all deletions that affect the ignored genomic position for read 1, i.e. Deletions and insertions
+		my $I_count_1 = 0;
+	
+		### if the (read 1) strand information is '-', the read 1 CIGAR string needs to be trimmed from the start
+		for (1..$ignore_3prime) {
+		  my $op = shift @comp_cigar_1; # adjusting composite CIGAR string by removing $ignore_3prime operations, here the first value of the array
+		  # print join ("",@comp_cigar_1),"\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $D_count_1++;
+		    $op = shift @comp_cigar_1;
+		    # print join ("",@comp_cigar_1),"\n";
+		  }
+
+		  if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		    $I_count_1++;
+		  }
+		}
+
+		# print "Final truncated CIGAR string reverse_read:\n";
+		# print join ("",@comp_cigar_1),"\n";
+		
+		# Here we need to add the length ignore_3prime to the read starting position
+		# adjustment of the true start position of this reverse read will take place later in the methylation extraction step
+		$start_read_1 += $ignore_3prime + $D_count_1 - $I_count_1;
+		
+	      }
+	    }
+	  }
+	
+	  if ($ignore_3prime_r2 and $meth_call_2) { # if the methylation call string is undefined at this point we don't need to process the read any further
+	
+	    ### Clipping off the last <int> number of bases from the methylation call string as specified with '--ignore_3prime_r2 <int>' for read 2	
+	    ### the methylation calls have already been reversed where necessary
+
+	    if ( (length($meth_call_2) - $ignore_3prime_r2) <= 0){
+	      $meth_call_2 = undef; # will skip this read entirely since the read is shorter than the portion to be ignored
+	    }
+	    else {
+	      $meth_call_2 = substr($meth_call_2,0,length($meth_call_2) - $ignore_3prime_r2);
+	      # warn "truncated meth_call 2:\n$meth_call_2\n";
+	
+	      ### If we are ignoring a part of the sequence we also need to adjust the cigar string and the positions accordingly
+	
+	      if ($strand eq '+') {
+		
+		### if the (read 1) strand information is '+', clipping the 3' end of read 2 does potentially affect the starting position of read 2 (reverse strand alignment)
+		### if the (read 1) strand information is '+', read 2 needs to be trimmed from the start
+		
+		my $D_count_2 = 0; # counting all deletions that affect the ignored genomic position for read 2, i.e. Deletions and insertions
+		my $I_count_2 = 0;
+		
+		for (1..$ignore_3prime_r2) {
+		  my $op = shift @comp_cigar_2; # adjusting composite CIGAR string by removing $ignore operations, here the first value of the array
+		  # print "$_ deleted $op from 3' end\n";
+		  # print join ("",@comp_cigar_2),"\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $D_count_2++;
+		    $op = shift @comp_cigar_2;
+		    # print "$_ deleted $op from 3' end\n";
+		    # print join ("",@comp_cigar_2),"\n";
+		  }
+
+		  if ($op eq 'I') { # adjusting the genomic position for insertions (I)
+		    $I_count_2++;
+		  }
+		}
+		
+		# print "Final truncated CIGAR string 2 (+ alignment):\n";
+		# print join ("",@comp_cigar_2),"\n";
+		
+		# Here we need to add the length ignore_3prime_r2 to the read starting position
+		# adjustment of the true start position of this reverse read will take place later in the methylation extraction step
+		$start_read_2 += $ignore_3prime_r2 + $D_count_2 - $I_count_2;
+		
+		# print "start read 2 $start_read_2\t ignore R2: $ignore_r2\t D count 2: $D_count_2\tI_count 2: $I_count_2\n";
+	      }
+	      elsif ($strand eq '-') {
+		### if the (read 1) strand information is '-', clipping the 3' end of read 2 does not affect its starting position (forward strand alignment)
+		### ignore_r2 5' has already been taken care of at this stage, if relevant at all
+		
+		### if the (read 1) strand information is '-', read 2 needs to be trimmed from the end
+		
+		for (1..$ignore_3prime_r2) {
+		  my $op = pop @comp_cigar_2; # adjusting composite CIGAR string of read 2 by removing $ignore operations from the start
+		  # print "$_ deleted $op\n";
+		  # print join ("",@comp_cigar_2),"\n";
+		
+		  while ($op eq 'D') { # repeating this for deletions (D)
+		    $op = pop @comp_cigar_2;
+		    # print "$_ deleted $op\n";
+		    # print join ("",@comp_cigar_2),"\n";
+		  }
+		}
+		
+		# print "Final truncated CIGAR string 2 (- alignment):\n";
+		# print join ("",@comp_cigar_2),"\n";
+		
+	      }
+	    }
+	  }
+	
+	  if ($ignore_3prime and $meth_call_1){ # if the methylation call string is undefined at this point we don't need any new CIGAR string
+	
+	    ### reconstituting shortened CIGAR string 1
+	    my $new_cigar_1;
+	    my $count_1 = 0;
+	    my $last_op_1;
+	    # print "ignore_3prime adjusted CIGAR 1: @comp_cigar_1\n";
+	    foreach my $op (@comp_cigar_1) {
+	      unless (defined $last_op_1){
+		$last_op_1 = $op;
+		++$count_1;
+		next;
+	      }
+	      if ($last_op_1 eq $op) {
+		++$count_1;
+	      }
+	      else {
+		$new_cigar_1 .= "$count_1$last_op_1";
+		$last_op_1 = $op;
+		$count_1 = 1;
+	      }
+	    }
+	    $new_cigar_1 .= "$count_1$last_op_1"; # appending the last operation and count
+	    $cigar_1 = $new_cigar_1;
+	    # warn "ignore_3prime adjusted CIGAR 1 scalar: $cigar_1\n";
+	  }
+
+	  if ($ignore_3prime_r2 and $meth_call_2){ # if the methylation call string is undefined at this point we don't need any new CIGAR string
+
+	    ### reconstituting shortened CIGAR string 2
+	    my $new_cigar_2;
+	    my $count_2 = 0;
+	    my $last_op_2;
+	    # print "ignore_3prime_r2 adjusted CIGAR 2: @comp_cigar_2\n";
+	    foreach my $op (@comp_cigar_2) {
+	      unless (defined $last_op_2){
+		$last_op_2 = $op;
+		++$count_2;
+		next;
+	      }
+	      if ($last_op_2 eq $op) {
+		++$count_2;
+	      }
+	      else {
+		$new_cigar_2 .= "$count_2$last_op_2";
+		$last_op_2 = $op;
+		$count_2 = 1;
+	      }
+	    }
+	    $new_cigar_2 .= "$count_2$last_op_2"; # appending the last operation and count
+	    $cigar_2 = $new_cigar_2;
+	    # warn "ignore_3prime_r2 adjusted CIGAR 2 scalar: $cigar_2\n";
+	  }
+
+	  ###########################
+	  ###  END IGNORE 3' END  ###
+	  ###########################
+
+
+	  ### Adjusting CIGAR string and starting position of reads in reverse orientation which we will pass to the extraction subroutine later on
+	
+	  if ($strand eq '+') {
+	    ### adjusting the start position for all reads mapping to the reverse strand, in this case read 2
+	    @comp_cigar_2  = reverse@comp_cigar_2; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
+	    # print "reverse: @comp_cigar_2\n";
+	
+	    my $MD_count_1 = 0;
+	    foreach (@comp_cigar_1) {
+	      ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
+	    }
+
+	    my $MD_count_2 = 0;
+	    foreach (@comp_cigar_2) {
+	      ++$MD_count_2 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
+	    }
+
+	    $end_read_1 = $start_read_1 + $MD_count_1 - 1;
+	    $start_read_2 += $MD_count_2 - 1; ## Passing on the start position on the reverse strand
+	  }
+	  else {
+	    ### adjusting the start position for all reads mapping to the reverse strand, in this case read 1
+	
+	    @comp_cigar_1  = reverse@comp_cigar_1; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
+	    # print "reverse: @comp_cigar_1\n";
+
+	    my $MD_count_1 = 0;
+	    foreach (@comp_cigar_1) {
+	      ++$MD_count_1 if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
+	    }
+
+	    $end_read_1 = $start_read_1;	
+	    $start_read_1 +=  $MD_count_1 - 1; ### Passing on the start position on the reverse strand
+	  }
+
+	  if ($strand eq '+') {
+	    ## we first pass the first read which is in + orientation on the forward strand; the last value is the read identity
+	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'+',$index,0,0,$cigar_1,1);
+	
+	    # we next pass the second read which is in - orientation on the reverse strand
+	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we can stop extracting methylation calls from read 2
+	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'-',$index,$no_overlap,$end_read_1,$cigar_2,2);
+	  }
+	  else {
+	    ## we first pass the first read which is in - orientation on the reverse strand
+	    print_individual_C_methylation_states_paired_end_files($meth_call_1,$chrom,$start_read_1,$id_1,'-',$index,0,0,$cigar_1,1);
+	
+	    # we next pass the second read which is in + orientation on the forward strand
+	    ### if --no_overlap was specified we also pass the end of read 1. If read 2 starts to overlap with read 1 we will stop extracting methylation calls from read 2
+	    print_individual_C_methylation_states_paired_end_files($meth_call_2,$chrom,$start_read_2,$id_2,'+',$index,$no_overlap,$end_read_1,$cigar_2,2);
+	  }
+	
+	  $methylation_call_strings_processed += 2; # paired-end = 2 methylation call strings
+	}	
+      }
+    }
+  } else {
+    die "Single-end or paired-end reads not specified properly\n";
+  }
+
+  $counting{sequences_count}          = $line_count;
+  $counting{methylation_call_strings} = $methylation_call_strings_processed;
+
+  if ($multicore == 1){
+    print_splitting_report ();
+  }
+  elsif ($multicore > 1){
+    print_splitting_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed);
+    print_mbias_report_multicore($report_filename,$offset,$line_count,$methylation_call_strings_processed);
+  }
+
+  return ($process_id,\@pids,$report_filename);
+
+}
+
+
+
+sub print_splitting_report{
+
+  ### Calculating methylation percentages if applicable
+  warn "\nProcessed $counting{sequences_count} lines in total\n";
+  warn "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n";
+  if ($report) {
+    print REPORT "\nProcessed $counting{sequences_count} lines in total\n";
+    print REPORT "Total number of methylation call strings processed: $counting{methylation_call_strings}\n\n";
+  }
+
+  my $percent_meCpG;
+  if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){
+    $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}));
+  }
+
+  my $percent_meCHG;
+  if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
+    $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}));
+  }
+
+  my $percent_meCHH;
+  if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){
+    $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}));
+  }
+
+  my $percent_non_CpG_methylation;
+  if ($merge_non_CpG){
+    if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
+      $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) );
+    }
+  }
+
+  if ($report){
+    ### detailed information about Cs analysed
+    print REPORT "Final Cytosine Methylation Report\n",'='x33,"\n";
+
+    my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
+    print REPORT "Total number of C's analysed:\t$total_number_of_C\n\n";
+
+    print REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
+    print REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
+    print REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n";
+
+    print REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
+    print REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
+    print REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n";
+
+    ### calculating methylated CpG percentage if applicable
+    if ($percent_meCpG){
+      print REPORT "C methylated in CpG context:\t${percent_meCpG}%\n";
+    }
+    else{
+      print REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
+    }
+
+    ### 2-Context Output
+    if ($merge_non_CpG){
+      if ($percent_non_CpG_methylation){
+	print REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n";
+      }
+      else{
+	print REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n";
+      }
+    }
+
+    ### 3 Context Output
+    else{
+      ### calculating methylated CHG percentage if applicable
+      if ($percent_meCHG){
+	print REPORT "C methylated in CHG context:\t${percent_meCHG}%\n";
+      }
+      else{
+	print REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
+      }
+
+      ### calculating methylated CHH percentage if applicable
+      if ($percent_meCHH){
+	print REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n";
+      }
+      else{
+	print REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n";
+      }
+    }
+  }
+
+  ### detailed information about Cs analysed for on-screen report
+  warn "Final Cytosine Methylation Report\n",'='x33,"\n";
+
+  my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
+  warn "Total number of C's analysed:\t$total_number_of_C\n\n";
+
+  warn "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
+  warn "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
+  warn"Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n";
+
+  warn "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
+  warn "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
+  warn"Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n";
+
+  ### printing methylated CpG percentage if applicable
+  if ($percent_meCpG){
+    warn "C methylated in CpG context:\t${percent_meCpG}%\n";
+  }
+  else{
+    warn "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
+  }
+
+  ### 2-Context Output
+  if ($merge_non_CpG){
+    if ($percent_non_CpG_methylation){
+      warn "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n";
+    }
+    else{
+      warn "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n";
+    }
+  }
+
+  ### 3-Context Output
+  else{
+    ### printing methylated CHG percentage if applicable
+    if ($percent_meCHG){
+      warn "C methylated in CHG context:\t${percent_meCHG}%\n";
+    }
+    else{
+      warn "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
+    }
+
+    ### printing methylated CHH percentage if applicable
+    if ($percent_meCHH){
+      warn "C methylated in CHH context:\t${percent_meCHH}%\n\n\n";
+    }
+    else{
+      warn "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n";
+    }
+  }
+}
+
+###
+
+sub print_splitting_report_multicore{
+
+  my ($report_filename,$offset,$line_count,$meth_call_strings) = @_;
+
+  # warn "\$report_filename is $report_filename\n";
+  my $special_report = $report_filename.".$offset";
+
+  open (SPECIAL_REPORT,'>',$special_report) or die $!;
+  # warn "line count\t$line_count\n";
+  # warn "meth call strings\t$meth_call_strings\n";
+
+  print SPECIAL_REPORT "line count\t$line_count\n";
+  print SPECIAL_REPORT "meth call strings\t$meth_call_strings\n";
+
+  ### Calculating methylation percentages if applicable
+  my $percent_meCpG;
+  if (($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}) > 0){
+    $percent_meCpG = sprintf("%.1f",100*$counting{total_meCpG_count}/($counting{total_meCpG_count}+$counting{total_unmethylated_CpG_count}));
+  }
+
+  my $percent_meCHG;
+  if (($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
+    $percent_meCHG = sprintf("%.1f",100*$counting{total_meCHG_count}/($counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}));
+  }
+
+  my $percent_meCHH;
+  if (($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}) > 0){
+    $percent_meCHH = sprintf("%.1f",100*$counting{total_meCHH_count}/($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}));
+  }
+
+  my $percent_non_CpG_methylation;
+  if ($merge_non_CpG){
+    if ( ($counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count}) > 0){
+      $percent_non_CpG_methylation = sprintf("%.1f",100* ( $counting{total_meCHH_count}+$counting{total_meCHG_count} ) / ( $counting{total_meCHH_count}+$counting{total_unmethylated_CHH_count}+$counting{total_meCHG_count}+$counting{total_unmethylated_CHG_count} ) );
+    }
+  }
+
+  if ($report){
+
+    ### detailed information about Cs analysed
+    print SPECIAL_REPORT "Final Cytosine Methylation Report\n",'='x33,"\n";
+
+    my $total_number_of_C = $counting{total_meCHG_count}+$counting{total_meCHH_count}+$counting{total_meCpG_count}+$counting{total_unmethylated_CHG_count}+$counting{total_unmethylated_CHH_count}+$counting{total_unmethylated_CpG_count};
+    print SPECIAL_REPORT "Total number of C's analysed:\t$total_number_of_C\n\n";
+
+    print SPECIAL_REPORT "Total methylated C's in CpG context:\t$counting{total_meCpG_count}\n";
+    print SPECIAL_REPORT "Total methylated C's in CHG context:\t$counting{total_meCHG_count}\n";
+    print SPECIAL_REPORT "Total methylated C's in CHH context:\t$counting{total_meCHH_count}\n\n";
+
+    print SPECIAL_REPORT "Total C to T conversions in CpG context:\t$counting{total_unmethylated_CpG_count}\n";
+    print SPECIAL_REPORT "Total C to T conversions in CHG context:\t$counting{total_unmethylated_CHG_count}\n";
+    print SPECIAL_REPORT "Total C to T conversions in CHH context:\t$counting{total_unmethylated_CHH_count}\n\n";
+
+    ### calculating methylated CpG percentage if applicable
+    if ($percent_meCpG){
+      print SPECIAL_REPORT "C methylated in CpG context:\t${percent_meCpG}%\n";
+    }
+    else{
+      print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CpG context if value was 0\n";
+    }
+
+    ### 2-Context Output
+    if ($merge_non_CpG){
+      if ($percent_non_CpG_methylation){
+	print SPECIAL_REPORT "C methylated in non-CpG context:\t${percent_non_CpG_methylation}%\n\n\n";
+      }
+      else{
+	print SPECIAL_REPORT "Can't determine percentage of methylated Cs in non-CpG context if value was 0\n\n\n";
+      }
+    }
+
+    ### 3 Context Output
+    else{
+      ### calculating methylated CHG percentage if applicable
+      if ($percent_meCHG){
+	print SPECIAL_REPORT "C methylated in CHG context:\t${percent_meCHG}%\n";
+      }
+      else{
+	print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHG context if value was 0\n";
+      }
+
+      ### calculating methylated CHH percentage if applicable
+      if ($percent_meCHH){
+	print SPECIAL_REPORT "C methylated in CHH context:\t${percent_meCHH}%\n\n\n";
+      }
+      else{
+	print SPECIAL_REPORT "Can't determine percentage of methylated Cs in CHH context if value was 0\n\n\n";
+      }
+    }
+  }
+  close SPECIAL_REPORT or warn "Failed to close filehandle for individual report $special_report\n";
+}
+
+
+###
+
+### INDIVIDUAL M-BIAS REPORTS
+
+sub print_mbias_report_multicore{
+
+  my ($report_filename,$offset,$line_count,$meth_call_strings) = @_;
+
+  # warn "\$report_filename is $report_filename\n";
+  my $special_mbias_report = $report_filename.".${offset}.mbias";
+
+  open (SPECIAL_MBIAS,'>',$special_mbias_report) or die $!;
+
+  # determining maximum read length
+  my $max_length_1 = 0;
+  my $max_length_2 = 0;
+
+  foreach my $context (keys %mbias_1){
+    foreach my $pos (sort {$a<=>$b} keys %{$mbias_1{$context}}){
+      $max_length_1 = $pos unless ($max_length_1 >= $pos);
+    }
+  }
+  if ($paired){
+    foreach my $context (keys %mbias_2){
+      foreach my $pos (sort {$a<=>$b} keys %{$mbias_2{$context}}){
+	$max_length_2 = $pos unless ($max_length_2 >= $pos);
+      }
+    }
+  }
+
+  if ($single){
+    # warn "Determining maximum read length for M-Bias plot\n";
+    # warn "Maximum read length of Read 1: $max_length_1\n\n";
+  }
+  else{
+    # warn "Determining maximum read lengths for M-Bias plots\n";
+    # warn "Maximum read length of Read 1: $max_length_1\n";
+    # warn "Maximum read length of Read 2: $max_length_2\n\n";
+  }
+
+  foreach my $context (qw(CpG CHG CHH)){
+
+    if ($paired){
+      print SPECIAL_MBIAS "$context context (R1)\n================\n";
+    }
+    else{
+      print SPECIAL_MBIAS "$context context\n===========\n";
+    }
+    print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n";
+
+    foreach my $pos (1..$max_length_1){
+
+      unless (defined $mbias_1{$context}->{$pos}->{meth}){
+	$mbias_1{$context}->{$pos}->{meth} = 0;
+      }
+      unless (defined $mbias_1{$context}->{$pos}->{un}){
+	$mbias_1{$context}->{$pos}->{un} = 0;
+      }
+
+      my $percent = '';
+      if (($mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) > 0){
+	$percent = sprintf("%.2f",$mbias_1{$context}->{$pos}->{meth} * 100/ ( $mbias_1{$context}->{$pos}->{meth} + $mbias_1{$context}->{$pos}->{un}) );
+      }
+      my $coverage = $mbias_1{$context}->{$pos}->{un} + $mbias_1{$context}->{$pos}->{meth};
+
+      print SPECIAL_MBIAS "$pos\t$mbias_1{$context}->{$pos}->{meth}\t$mbias_1{$context}->{$pos}->{un}\t$percent\t$coverage\n";
+    }
+    print SPECIAL_MBIAS "\n";
+  }
+
+  if ($paired){
+
+    foreach my $context (qw(CpG CHG CHH)){
+
+      print SPECIAL_MBIAS "$context context (R2)\n================\n";
+      print SPECIAL_MBIAS "position\tcount methylated\tcount unmethylated\t% methylation\tcoverage\n";
+
+      foreach my $pos (1..$max_length_2){
+	
+	unless (defined $mbias_2{$context}->{$pos}->{meth}){
+	  $mbias_2{$context}->{$pos}->{meth} = 0;
+	}
+	unless (defined $mbias_2{$context}->{$pos}->{un}){
+	  $mbias_2{$context}->{$pos}->{un} = 0;
+	}
+
+	my $percent = '';
+	if (($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) > 0){
+	  $percent = sprintf("%.2f",$mbias_2{$context}->{$pos}->{meth} * 100/ ($mbias_2{$context}->{$pos}->{meth} + $mbias_2{$context}->{$pos}->{un}) );
+	}
+	my $coverage = $mbias_2{$context}->{$pos}->{un} + $mbias_2{$context}->{$pos}->{meth};
+
+	print SPECIAL_MBIAS "$pos\t$mbias_2{$context}->{$pos}->{meth}\t$mbias_2{$context}->{$pos}->{un}\t$percent\t$coverage\n";
+      }	
+    }
+  }
+
+  close SPECIAL_MBIAS or warn "Failed to close filehandle for individual M-bias report $special_mbias_report\n";
+}
+
+
+###
+
+
+sub print_individual_C_methylation_states_paired_end_files{
+
+  my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$no_overlap,$end_read_1,$cigar,$read_identity) = @_;
+
+  unless (defined $meth_call) {
+    return; # skip this read
+  }
+
+  ### we will use the read identity for the M-bias plot to discriminate read 1 and read 2
+  die "Read identity was neither 1 nor 2: $read_identity\n\n" unless ($read_identity == 1 or $read_identity == 2);
+
+  my @methylation_calls = split(//,$meth_call);
+
+  #################################################################
+  ### . for bases not involving cytosines                       ###
+  ### X for methylated C in CHG context (was protected)         ###
+  ### x for not methylated C in CHG context (was converted)     ###
+  ### H for methylated C in CHH context (was protected)         ###
+  ### h for not methylated C in CHH context (was converted)     ###
+  ### Z for methylated C in CpG context (was protected)         ###
+  ### z for not methylated C in CpG context (was converted)     ###
+  ### U for methylated C in Unknown context (was protected)     ###
+  ### u for not methylated C in Unknown context (was converted) ###
+  #################################################################
+
+  my $methyl_CHG_count = 0;
+  my $methyl_CHH_count = 0;
+  my $methyl_CpG_count = 0;
+  my $unmethylated_CHG_count = 0;
+  my $unmethylated_CHH_count = 0;
+  my $unmethylated_CpG_count = 0;
+
+  my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions
+  my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels
+  my @comp_cigar;
+
+  ### Checking whether the CIGAR string is a linear genomic match or whether if requires indel processing
+  if ($cigar =~ /^\d+M$/){
+    # this check speeds up the extraction process by up to 60%!!!
+  }
+  else{ # parsing CIGAR string
+    my @len;
+    my @ops;
+    @len = split (/\D+/,$cigar); # storing the length per operation
+    @ops = split (/\d+/,$cigar); # storing the operation
+    shift @ops; # remove the empty first element
+
+    die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
+
+    foreach my $index (0..$#len){
+      foreach (1..$len[$index]){
+	# print  "$ops[$index]";
+	push @comp_cigar, $ops[$index];
+      }
+    }
+    # warn "\nDetected CIGAR string: $cigar\n";
+    # warn "Length of methylation call: ",length $meth_call,"\n";
+    # warn "number of operations: ",scalar @ops,"\n";
+    # warn "number of length digits: ",scalar @len,"\n\n";
+    # print @comp_cigar,"\n";
+    # print "$meth_call\n\n";
+    # sleep (1);
+  }
+
+  if ($strand eq '-') {
+
+    ### the  CIGAR string needs to be reversed, the methylation call has already been reversed above
+    if (@comp_cigar){
+      @comp_cigar  = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
+    }
+    #  print "reverse CIGAR string: @comp_cigar\n";
+
+    ### the start position of paired-end files has already been corrected, see above
+  }
+
+  ### THIS IS AN OPTIONAL 2-CONTEXT (CpG and non-CpG) SECTION IF --merge_non_CpG was specified
+
+  if ($merge_non_CpG) {
+    if ($no_overlap) { # this has to be read 2...
+
+      ### single-file CpG and non-CpG context output
+      if ($full) {
+	if ($strand eq '+') {
+	  for my $index (0..$#methylation_calls) {
+	
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+	
+	    ### Returning as soon as the methylation calls start overlapping
+	    if ($start+$index+$pos_offset >= $end_read_1) {
+	      return;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.'){}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only);
+	    }
+	  }
+	}
+	elsif ($strand eq '-') {
+	  for my $index (0..$#methylation_calls) {
+	
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+	
+	    ### Returning as soon as the methylation calls start overlapping
+	    if ($start-$index+$pos_offset <= $end_read_1) {
+	      return;
+	    }
+	
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only);
+	    }
+	  }
+	} else {
+	  die "The read orientation was neither + nor -: '$strand'\n";
+	}
+      }
+
+      ### strand-specific methylation output
+      else {
+	if ($strand eq '+') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    ### Returning as soon as the methylation calls start overlapping
+	    if ($start+$index+$pos_offset >= $end_read_1) {
+	      return;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	    }	
+	  }
+	} elsif ($strand eq '-') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    ### Returning as soon as the methylation calls start overlapping
+	    if ($start-$index+$pos_offset <= $end_read_1) {
+	      return;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	    }
+	  }
+	} else {
+	  die "The strand orientation was neither + nor -: '$strand'/n";
+	}
+      }
+    }
+
+    ### this is the default paired-end procedure allowing overlaps and using every single C position
+    ### Still within the 2-CONTEXT ONLY optional section
+    else {
+      ### single-file CpG and non-CpG context output
+      if ($full) {
+	if ($strand eq '+') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only);
+	    }
+	  }
+	} elsif ($strand eq '-') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	       if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only);
+	    }
+	  }
+	} else {
+	  die "The strand orientation as neither + nor -: '$strand'\n";
+	}
+      }
+
+      ### strand-specific methylation output
+      ### still within the 2-CONTEXT optional section
+      else {
+	if ($strand eq '+') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	       if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	    }
+	  }
+	} elsif ($strand eq '-') {
+	  for my $index (0..$#methylation_calls) {
+
+	    if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	      # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	      my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	      $cigar_offset += $cigar_mod;
+	      $pos_offset += $pos_mod;
+	    }
+
+	    if ($methylation_calls[$index] eq 'X') {
+	      $counting{total_meCHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'x') {
+	      $counting{total_unmethylated_CHG_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'Z') {
+	      $counting{total_meCpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'z') {
+	      $counting{total_unmethylated_CpG_count}++;
+	      print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CpG}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CpG}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'H') {
+	      $counting{total_meCHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{meth}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{meth}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq 'h') {
+	      $counting{total_unmethylated_CHH_count}++;
+	      print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	      if ($read_identity == 1){
+		$mbias_1{CHH}->{$index+1}->{un}++;
+	      }
+	      else{
+		$mbias_2{CHH}->{$index+1}->{un}++;
+	      }
+	    }
+	    elsif ($methylation_calls[$index] eq '.') {}
+	    elsif (lc$methylation_calls[$index] eq 'u'){}
+	    else{
+	      die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	    }
+	  }
+	} else {
+	  die "The strand orientation as neither + nor -: '$strand'\n";
+	}
+      }
+    }
+  }
+
+  ############################################
+  ### THIS IS THE DEFAULT 3-CONTEXT OUTPUT ###
+  ############################################
+
+  elsif ($no_overlap) {
+    ### single-file CpG, CHG and CHH context output
+    if ($full) {
+      if ($strand eq '+') {
+	for my $index (0..$#methylation_calls) {
+	
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  ### Returning as soon as the methylation calls start overlapping
+	  if ($start+$index+$pos_offset >= $end_read_1) {
+	    return;
+	  }
+	
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  } 
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } elsif ($strand eq '-') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  ### Returning as soon as the methylation calls start overlapping
+	  if ($start-$index+$pos_offset <= $end_read_1) {
+	    return;
+	  }
+	
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } else {
+	die "The strand orientation as neither + nor -: '$strand'\n";
+      }
+    }
+
+    ### strand-specific methylation output
+    else {
+      if ($strand eq '+') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  ### Returning as soon as the methylation calls start overlapping
+	  if ($start+$index+$pos_offset >= $end_read_1) {
+	    return;
+	  }
+	
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }	
+	}
+      } elsif ($strand eq '-') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  ### Returning as soon as the methylation calls start overlapping
+	  if ($start-$index+$pos_offset <= $end_read_1) {
+	    return;
+	  }
+	
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } else {
+	die "The strand orientation as neither + nor -: '$strand'\n";
+      }
+    }
+  }
+
+  ### this is the paired-end procedure allowing overlaps and using every single C position
+  else {
+    ### single-file CpG, CHG and CHH context output
+    if ($full) {
+      if ($strand eq '+') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } elsif ($strand eq '-') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } else {
+	die "The strand orientation as neither + nor -: '$strand'\n";
+      }
+    }
+
+    ### strand-specific methylation output
+    else {
+      if ($strand eq '+') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } elsif ($strand eq '-') {
+	for my $index (0..$#methylation_calls) {
+
+	  if ($cigar and @comp_cigar){ # only needed for SAM reads with InDels
+	    # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	    my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	    $cigar_offset += $cigar_mod;
+	    $pos_offset += $pos_mod;
+	  }
+
+	  if ($methylation_calls[$index] eq 'X') {
+	    $counting{total_meCHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'x') {
+	    $counting{total_unmethylated_CHG_count}++;
+	    print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'Z') {
+	    $counting{total_meCpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'z') {
+	    $counting{total_unmethylated_CpG_count}++;
+	    print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CpG}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CpG}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'H') {
+	    $counting{total_meCHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{meth}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{meth}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq 'h') {
+	    $counting{total_unmethylated_CHH_count}++;
+	    print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	    if ($read_identity == 1){
+	      $mbias_1{CHH}->{$index+1}->{un}++;
+	    }
+	    else{
+	      $mbias_2{CHH}->{$index+1}->{un}++;
+	    }
+	  }
+	  elsif ($methylation_calls[$index] eq '.') {}
+	  elsif (lc$methylation_calls[$index] eq 'u'){}
+	  else{
+	    die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	  }
+	}
+      } else {
+	die "The strand orientation as neither + nor -: '$strand'\n";
+      }
+    }
+  }
+}
+
+sub check_cigar_string {
+  my ($index,$cigar_offset,$pos_offset,$strand,$comp_cigar) = @_;
+  # print "$index\t$cigar_offset\t$pos_offset\t$strand\t";
+  my ($new_cigar_offset,$new_pos_offset) = (0,0);
+
+  if ($strand eq '+') {
+    #  print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t";
+
+    if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
+      #  warn "position needs no adjustment\n";
+    }
+
+    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence
+      $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position
+      # warn "adjusted genomic position by -1 bp (insertion)\n";
+    }
+
+    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
+      $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
+      $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position
+      # warn "adjusted genomic position by +1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n";
+
+      while ( ($index + $cigar_offset + $new_cigar_offset)  < (scalar @$comp_cigar) ){	
+	if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
+	  #  warn "position needs no adjustment\n";
+	  last;
+	}
+	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){
+	  $new_pos_offset -= 1; # we need to subtract the length of inserted bases from the genomic position
+	  # warn "adjusted genomic position by another -1 bp (insertion)\n";
+	  last;
+	}
+	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
+	  $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
+	  $new_pos_offset += 1; # we need to add the length of deleted bases to get the genomic position
+	  # warn "adjusted genomic position by another +1 bp (deletion)\n";
+	}
+	else{
+	  die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
+	}
+      }
+    }
+    else{
+      die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
+    }
+  }
+
+  elsif ($strand eq '-') {
+    # print "### $strand strand @$comp_cigar[$index + $cigar_offset]\t";
+
+    if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
+     # warn "position needs no adjustment\n";
+    }
+
+    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){ # insertion in the read sequence
+      $new_pos_offset += 1; # we need to add the length of inserted bases to the genomic position
+      # warn "adjusted genomic position by +1 bp (insertion)\n";
+    }
+
+    elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
+      $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
+      $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position
+      # warn "adjusted genomic position by -1 bp (deletion). Now looping through the CIGAR string until we hit another M or I\n";
+
+      while ( ($index + $cigar_offset + $new_cigar_offset)  < (scalar @$comp_cigar) ){	
+	if (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'M'){ # sequence position matches the genomic position
+	  # warn "Found new 'M' operation; position needs no adjustment\n";
+	  last;
+	}
+	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'I'){
+	  $new_pos_offset += 1; # we need to subtract the length of inserted bases from the genomic position
+	  # warn "Found new 'I' operation; adjusted genomic position by another +1 bp (insertion)\n";
+	  last;
+	}
+	elsif (@$comp_cigar[$index + $cigar_offset + $new_cigar_offset] eq 'D'){ # deletion in the read sequence
+	  $new_cigar_offset += 1; # the composite cigar string does no longer match the methylation call index
+	  $new_pos_offset -= 1; # we need to subtract the length of deleted bases to get the genomic position
+	  # warn "adjusted genomic position by another -1 bp (deletion)\n";
+	}
+	else{
+	  die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
+	}
+      }
+    }
+    else{
+      die "The CIGAR string contained undefined operations in addition to 'M', 'I' and 'D': '@$comp_cigar[$index + $cigar_offset + $new_cigar_offset]'\n";
+    }
+  }
+  # print "new cigar offset: $new_cigar_offset\tnew pos offset: $new_pos_offset\n";
+  return ($new_cigar_offset,$new_pos_offset);
+}
+
+sub print_individual_C_methylation_states_single_end{
+
+  my ($meth_call,$chrom,$start,$id,$strand,$filehandle_index,$cigar) = @_;
+  my @methylation_calls = split(//,$meth_call);
+
+  #################################################################
+  ### . for bases not involving cytosines                       ###
+  ### X for methylated C in CHG context (was protected)         ###
+  ### x for not methylated C in CHG context (was converted)     ###
+  ### H for methylated C in CHH context (was protected)         ###
+  ### h for not methylated C in CHH context (was converted)     ###
+  ### Z for methylated C in CpG context (was protected)         ###
+  ### z for not methylated C in CpG context (was converted)     ###
+  #################################################################
+
+  my $methyl_CHG_count = 0;
+  my $methyl_CHH_count = 0;
+  my $methyl_CpG_count = 0;
+  my $unmethylated_CHG_count = 0;
+  my $unmethylated_CHH_count = 0;
+  my $unmethylated_CpG_count = 0;
+
+  my $pos_offset = 0; # this is only relevant for SAM reads with insertions or deletions
+  my $cigar_offset = 0; # again, this is only relevant for SAM reads containing indels
+
+  my @comp_cigar;
+
+  if ($cigar){ # parsing CIGAR string
+
+    ### Checking whether the CIGAR string is a linear genomic match or whether it requires indel processing
+    if ($cigar =~ /^\d+M$/){
+      #  warn "See!? I told you so! $cigar\n";
+      # sleep(1);
+    }
+    else{
+
+      my @len;
+      my @ops;
+
+      @len = split (/\D+/,$cigar); # storing the length per operation
+      @ops = split (/\d+/,$cigar); # storing the operation
+      shift @ops; # remove the empty first element
+      # die "CIGAR string contained a non-matching number of lengths and operations: id: $id\nmeth call: $meth_call\nCIGAR: $cigar\n".join(" ",@len)."\n".join(" ",@ops)."\n" unless (scalar @len == scalar @ops);
+      die "CIGAR string contained a non-matching number of lengths and operations\n" unless (scalar @len == scalar @ops);
+
+      foreach my $index (0..$#len){
+	foreach (1..$len[$index]){
+	  # print  "$ops[$index]";
+	  push @comp_cigar, $ops[$index];
+	}
+      }
+    }
+    # warn "\nDetected CIGAR string: $cigar\n";
+    # warn "Length of methylation call: ",length $meth_call,"\n";
+    # warn "number of operations: ",scalar @ops,"\n";
+    # warn "number of length digits: ",scalar @len,"\n\n";
+    # print @comp_cigar,"\n";
+    # print "$meth_call\n\n";
+    # sleep (1);
+  }
+
+  ### adjusting the start position for all reads mapping to the reverse strand
+  if ($strand eq '-') {
+
+    if (@comp_cigar){ # only needed for SAM reads with InDels
+      @comp_cigar  = reverse@comp_cigar; # the CIGAR string needs to be reversed for all reads aligning to the reverse strand, too
+      # print @comp_cigar,"\n";
+    }
+
+    unless ($ignore){  ### if --ignore was specified the start position has already been corrected
+
+      if ($cigar){ ### SAM format
+	if ($cigar =~ /^(\d+)M$/){ # linear match
+	  $start += $1 - 1;
+	}
+	else{ # InDel read
+	  my $MD_count = 0;
+	  foreach (@comp_cigar){
+	    ++$MD_count if ($_ eq 'M' or $_ eq 'D'); # Matching bases or deletions affect the genomic position of the 3' ends of reads, insertions don't
+	  }
+	  $start += $MD_count - 1;
+	}
+      }
+      else{ ### vanilla format
+	$start += length($meth_call)-1;
+      }
+    }
+  }
+
+  ### THIS IS THE CpG and Non-CpG SECTION (OPTIONAL)
+
+  ### single-file CpG and other-context output
+  if ($full and $merge_non_CpG) {
+    if ($strand eq '+') {
+      for my $index (0..$#methylation_calls) {
+	
+	if ($cigar and @comp_cigar){ # only needed for SAM alignments with InDels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition+index: ",$start+$index,"\t";
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+	
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  #  print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{CpG_context}} $line unless($mbias_only);
+	  # print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{CpG_context}} $line unless($mbias_only);
+	  # print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  # print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  # print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    elsif ($strand eq '-') {
+
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM entries with InDels
+	  # print "index: $index\tmethylation_call: $methylation_calls[$index]\tposition-index: ",$start-$index,"\t";
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{CpG_context}} $line unless($mbias_only);
+	  #print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{CpG_context}} $line unless($mbias_only);
+	  #print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  my $line = join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  #print {$fhs{other_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  my $line = join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n";
+	  print {$fhs{other_context}} $line unless($mbias_only);
+	  #print {$fhs{other_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.'){}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    else {
+      die "The strand information was neither + nor -: $strand\n";
+    }
+  }
+
+  ### strand-specific methylation output
+  elsif ($merge_non_CpG) {
+    if ($strand eq '+') {
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    elsif ($strand eq '-') {
+
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+    	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{$filehandle_index}->{other_c}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    else {
+      die "The strand information was neither + nor -: $strand\n";
+    }
+  }
+
+  ### THIS IS THE 3-CONTEXT (CpG, CHG and CHH) DEFAULT SECTION
+
+  elsif ($full) {
+    if ($strand eq '+') {
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+	
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n" unless($mbias_only);
+	}
+      }
+    }
+    elsif ($strand eq '-') {
+
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+	
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{CHG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{CHG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{CpG_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{CpG_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{CHH_context}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{CHH_context}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    else {
+      die "The read had a strand orientation which was neither + nor -: $strand\n";
+    }
+  }
+
+  ### strand-specific methylation output
+  else {
+    if ($strand eq '+') {
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start+$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    elsif ($strand eq '-') {
+
+      for my $index (0..$#methylation_calls) {
+	### methylated Cs (any context) will receive a forward (+) orientation
+	### not methylated Cs (any context) will receive a reverse (-) orientation
+
+	if ($cigar and @comp_cigar){ # only needed for SAM reads with Indels
+	  my ($cigar_mod,$pos_mod) = check_cigar_string($index,$cigar_offset,$pos_offset,$strand,\@comp_cigar);	
+	  $cigar_offset += $cigar_mod;
+	  $pos_offset += $pos_mod;
+	}
+
+	if ($methylation_calls[$index] eq 'X') {
+	  $counting{total_meCHG_count}++;
+	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'x') {
+	  $counting{total_unmethylated_CHG_count}++;
+	  print {$fhs{$filehandle_index}->{CHG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'Z') {
+	  $counting{total_meCpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'z') {
+	  $counting{total_unmethylated_CpG_count}++;
+	  print {$fhs{$filehandle_index}->{CpG}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CpG}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq 'H') {
+	  $counting{total_meCHH_count}++;
+	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'+',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{meth}++;
+	}
+	elsif ($methylation_calls[$index] eq 'h') {
+	  $counting{total_unmethylated_CHH_count}++;
+	  print {$fhs{$filehandle_index}->{CHH}} join ("\t",$id,'-',$chrom,$start-$index+$pos_offset,$methylation_calls[$index])."\n" unless($mbias_only);
+	  $mbias_1{CHH}->{$index+1}->{un}++;
+	}
+	elsif ($methylation_calls[$index] eq '.') {}
+	elsif (lc$methylation_calls[$index] eq 'u'){}
+	else{
+	  die "The methylation call string contained the following unrecognised character: $methylation_calls[$index]\n";
+	}
+      }
+    }
+    else {
+      die "The strand information was neither + nor -: $strand\n";
+    }
+  }
+}
+
+sub open_output_filehandles{
+
+  my $filename = shift;
+
+  my $output_filename = (split (/\//,$filename))[-1];
+  my $report_filename = $output_filename;
+
+  ### OPENING OUTPUT-FILEHANDLES
+  if ($report) {
+    $report_filename =~ s/\.sam$//;
+    $report_filename =~ s/\.txt$//;
+    $report_filename =~ s/$/_splitting_report.txt/;
+    $report_filename = $output_dir . $report_filename;
+    open (REPORT,'>',$report_filename) or die "Failed to write to file $report_filename $!\n";
+  }
+
+  if ($report) {
+
+    print REPORT "$output_filename\n\n";
+    print REPORT "Parameters used to extract methylation information:\n";
+    print REPORT "Bismark Extractor Version: $version\n";
+
+    if ($paired) {
+      if ($vanilla) {
+	print REPORT "Bismark result file: paired-end (vanilla Bismark format)\n";
+      } else {
+	print REPORT "Bismark result file: paired-end (SAM format)\n"; # default
+      }
+    }
+
+    if ($single) {
+      if ($vanilla) {
+	print REPORT "Bismark result file: single-end (vanilla Bismark format)\n";
+      } else {
+	print REPORT "Bismark result file: single-end (SAM format)\n"; # default
+      }
+    }
+    if ($single){
+      if ($ignore) {
+	print REPORT "Ignoring first $ignore bp\n";
+      }
+      if ($ignore_3prime) {
+	print REPORT "Ignoring last $ignore_3prime bp\n";
+      }
+    }
+    else{ # paired-end
+      if ($ignore) {
+	print REPORT "Ignoring first $ignore bp of Read 1\n";
+      }
+      if ($ignore_r2){
+	print REPORT "Ignoring first $ignore_r2 bp of Read 2\n";
+      }
+
+      if ($ignore_3prime) {
+	print REPORT "Ignoring last $ignore_3prime bp of Read 1\n";
+      }
+      if ($ignore_3prime_r2){
+	print REPORT "Ignoring last $ignore_3prime_r2 bp of Read 2\n";
+      }
+
+    }
+
+    if ($full) {
+      print REPORT "Output specified: comprehensive\n";
+    } else {
+      print REPORT "Output specified: strand-specific (default)\n";
+    }
+
+    if ($no_overlap) {
+      print REPORT "No overlapping methylation calls specified\n";
+    }
+    if ($genomic_fasta) {
+      print REPORT "Genomic equivalent sequences will be printed out in FastA format\n";
+    }
+    if ($merge_non_CpG) {
+      print REPORT "Methylation in CHG and CHH context will be merged into \"non-CpG context\" output\n";
+    }
+
+    print REPORT "\n";
+  }
+
+  #####   open (OUT,"| gzip -c - > $output_dir$outfile") or die "Failed to write to $outfile: $!\n";
+
+  ### CpG-context and non-CpG context. THIS SECTION IS OPTIONAL
+  ### if --comprehensive AND --merge_non_CpG was specified we are only writing out one CpG-context and one Any-Other-context result file
+  if ($full and $merge_non_CpG) {
+    my $cpg_output = my $other_c_output = $output_filename;
+    ### C in CpG context
+    $cpg_output =~ s/^/CpG_context_/;
+    $cpg_output =~ s/sam$/txt/;
+    $cpg_output =~ s/bam$/txt/;
+    $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/);
+    $cpg_output = $output_dir . $cpg_output;
+
+    if ($gzip){
+      $cpg_output .= '.gz';
+      open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+    }
+    else{ ### disclaimer: I am aware of "The Useless Use of Cat Awards", but I saw no other option...
+      open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+      # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only);
+    push @sorting_files,$cpg_output;
+
+    unless ($no_header) {
+      print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### C in any other context than CpG
+    $other_c_output =~ s/^/Non_CpG_context_/;
+    $other_c_output =~ s/sam$/txt/;
+    $other_c_output =~ s/bam$/txt/;
+    $other_c_output =~ s/$/.txt/ unless ($other_c_output =~ /\.txt$/);
+    $other_c_output = $output_dir . $other_c_output;
+
+    if ($gzip){
+      $other_c_output .= '.gz';
+      open ($fhs{other_context},"| gzip -c - > $other_c_output") or die "Failed to write to $other_c_output $! \n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{other_context},"| cat > $other_c_output") or die "Failed to write to $other_c_output $!\n" unless($mbias_only);
+      #   open ($fhs{other_context},'>',$other_c_output) or die "Failed to write to $other_c_output $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in any other context to $other_c_output\n" unless($mbias_only);
+    push @sorting_files,$other_c_output;
+
+
+    unless ($no_header) {
+      print {$fhs{other_context}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+  }
+
+  ### if only --merge_non_CpG was specified we will write out 8 different output files, depending on where the (first) unique best alignment has been found
+  elsif ($merge_non_CpG) {
+
+    my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename;
+
+    ### For cytosines in CpG context
+    $cpg_ot =~ s/^/CpG_OT_/;
+    $cpg_ot =~ s/sam$/txt/;
+    $cpg_ot =~ s/bam$/txt/;
+    $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/);
+    $cpg_ot = $output_dir . $cpg_ot;
+
+    if ($gzip){
+      $cpg_ot .= '.gz';
+      open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+      # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only);
+    push @sorting_files,$cpg_ot;
+
+    unless($no_header){
+      print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ctot =~ s/^/CpG_CTOT_/;
+    $cpg_ctot =~ s/sam$/txt/;
+    $cpg_ctot =~ s/bam$/txt/;
+    $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/);
+    $cpg_ctot = $output_dir . $cpg_ctot;
+
+    if ($gzip){
+      $cpg_ctot .= '.gz';
+      open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+      # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only);
+    push @sorting_files,$cpg_ctot;
+
+    unless($no_header){
+      print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ctob =~ s/^/CpG_CTOB_/;
+    $cpg_ctob =~ s/sam$/txt/;
+    $cpg_ctob =~ s/bam$/txt/;
+    $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/);
+    $cpg_ctob = $output_dir . $cpg_ctob;
+
+    if ($gzip){
+      $cpg_ctob .= '.gz';
+      open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+      # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only);
+    push @sorting_files,$cpg_ctob;
+
+    unless($no_header){
+      print {$fhs{2}->{CpG}}  "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ob =~ s/^/CpG_OB_/;
+    $cpg_ob =~ s/sam$/txt/;
+    $cpg_ob =~ s/bam$/txt/;
+    $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/);
+    $cpg_ob = $output_dir . $cpg_ob;
+
+    if ($gzip){
+      $cpg_ob .= '.gz';
+      open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+      # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only);
+    push @sorting_files,$cpg_ob;
+
+    unless($no_header){
+      print {$fhs{3}->{CpG}}  "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### For cytosines in Non-CpG (CC, CT or CA) context
+    my $other_c_ot = my $other_c_ctot = my $other_c_ctob = my $other_c_ob = $output_filename;
+
+    $other_c_ot =~ s/^/Non_CpG_OT_/;
+    $other_c_ot =~ s/sam$/txt/;
+    $other_c_ot =~ s/bam$/txt/;
+    $other_c_ot =~ s/$/.txt/ unless ($other_c_ot =~ /\.txt$/);
+    $other_c_ot = $output_dir . $other_c_ot;
+
+    if ($gzip){
+      $other_c_ot .= '.gz';
+      open ($fhs{0}->{other_c},"| gzip -c - > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{0}->{other_c},"| cat > $other_c_ot") or die "Failed to write to $other_c_ot $!\n" unless($mbias_only);
+      # open ($fhs{0}->{other_c},'>',$other_c_ot) or die "Failed to write to $other_c_ot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in any other context from the original top strand to $other_c_ot\n" unless($mbias_only);
+    push @sorting_files,$other_c_ot;
+
+    unless($no_header){
+      print {$fhs{0}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $other_c_ctot =~ s/^/Non_CpG_CTOT_/;
+    $other_c_ctot =~ s/sam$/txt/;
+    $other_c_ctot =~ s/bam$/txt/;
+    $other_c_ctot =~ s/$/.txt/ unless ($other_c_ctot =~ /\.txt$/);
+    $other_c_ctot = $output_dir . $other_c_ctot;
+
+    if ($gzip){
+      $other_c_ctot .= '.gz';
+      open ($fhs{1}->{other_c},"| gzip -c - > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{1}->{other_c},"|  cat > $other_c_ctot") or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only);
+      # open ($fhs{1}->{other_c},'>',$other_c_ctot) or die "Failed to write to $other_c_ctot $!\n" unless($mbias_only);
+   }
+
+    warn "Writing result file containing methylation information for C in any other context from the complementary to original top strand to $other_c_ctot\n" unless($mbias_only);
+    push @sorting_files,$other_c_ctot;
+
+    unless($no_header){
+      print {$fhs{1}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $other_c_ctob =~ s/^/Non_CpG_CTOB_/;
+    $other_c_ctob =~ s/sam$/txt/;
+    $other_c_ctob =~ s/bam$/txt/;
+    $other_c_ctob =~ s/$/.txt/ unless ($other_c_ctob =~ /\.txt$/);
+    $other_c_ctob = $output_dir . $other_c_ctob;
+
+    if ($gzip){
+      $other_c_ctob .= '.gz';
+      open ($fhs{2}->{other_c},"| gzip -c - > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{2}->{other_c},"| cat > $other_c_ctob") or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only);
+      # open ($fhs{2}->{other_c},'>',$other_c_ctob) or die "Failed to write to $other_c_ctob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in any other context from the complementary to original bottom strand to $other_c_ctob\n" unless($mbias_only);
+    push @sorting_files,$other_c_ctob;
+
+    unless($no_header){
+      print {$fhs{2}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $other_c_ob =~ s/^/Non_CpG_OB_/;
+    $other_c_ob =~ s/sam$/txt/;
+    $other_c_ob =~ s/sam$/txt/;
+    $other_c_ob =~ s/$/.txt/ unless ($other_c_ob =~ /\.txt$/);
+    $other_c_ob = $output_dir . $other_c_ob;
+
+    if ($gzip){
+      $other_c_ob .= '.gz';
+      open ($fhs{3}->{other_c},"| gzip -c - > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{3}->{other_c},"| cat > $other_c_ob") or die "Failed to write to $other_c_ob $!\n" unless($mbias_only);
+      # open ($fhs{3}->{other_c},'>',$other_c_ob) or die "Failed to write to $other_c_ob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in any other context from the original bottom strand to $other_c_ob\n\n" unless($mbias_only);
+    push @sorting_files,$other_c_ob;
+
+    unless($no_header){
+      print {$fhs{3}->{other_c}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+  }
+  ### THIS SECTION IS THE DEFAULT (CpG, CHG and CHH context)
+
+  ### if --comprehensive was specified we are only writing one file per context
+  elsif ($full) {
+    my $cpg_output = my $chg_output =  my $chh_output = $output_filename;
+    ### C in CpG context
+    $cpg_output =~ s/^/CpG_context_/;
+    $cpg_output =~ s/sam$/txt/;
+    $cpg_output =~ s/bam$/txt/;
+    $cpg_output =~ s/$/.txt/ unless ($cpg_output =~ /\.txt$/);
+    $cpg_output = $output_dir . $cpg_output;
+
+    if ($gzip){
+      $cpg_output .= '.gz';
+      open ($fhs{CpG_context},"| gzip -c - > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{CpG_context},"| cat > $cpg_output") or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+      # open ($fhs{CpG_context},'>',$cpg_output) or die "Failed to write to $cpg_output $! \n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context to $cpg_output\n" unless($mbias_only);
+    push @sorting_files,$cpg_output;
+
+    unless($no_header){
+      print {$fhs{CpG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### C in CHG context
+    $chg_output =~ s/^/CHG_context_/;
+    $chg_output =~ s/sam$/txt/;
+    $chg_output =~ s/bam$/txt/;
+    $chg_output =~ s/$/.txt/ unless ($chg_output =~ /\.txt$/);
+    $chg_output = $output_dir . $chg_output;
+
+    if ($gzip){
+      $chg_output .= '.gz';
+      open ($fhs{CHG_context},"| gzip -c - > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{CHG_context},"| cat > $chg_output") or die "Failed to write to $chg_output $!\n" unless($mbias_only);
+      # open ($fhs{CHG_context},'>',$chg_output) or die "Failed to write to $chg_output $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHG context to $chg_output\n" unless($mbias_only);
+    push @sorting_files,$chg_output;
+
+    unless($no_header){
+      print {$fhs{CHG_context}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### C in CHH context
+    $chh_output =~ s/^/CHH_context_/;
+    $chh_output =~ s/sam$/txt/;
+    $chh_output =~ s/bam$/txt/;
+    $chh_output =~ s/$/.txt/ unless ($chh_output =~ /\.txt$/);
+    $chh_output = $output_dir . $chh_output;
+
+    if ($gzip){
+      $chh_output .= '.gz';
+      open ($fhs{CHH_context},"| gzip -c - > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{CHH_context},"| cat > $chh_output") or die "Failed to write to $chh_output $!\n" unless($mbias_only);
+      # open ($fhs{CHH_context},'>',$chh_output) or die "Failed to write to $chh_output $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHH context to $chh_output\n" unless($mbias_only);
+    push @sorting_files, $chh_output;
+
+    unless($no_header){
+      print {$fhs{CHH_context}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+  }
+  ### else we will write out 12 different output files, depending on where the (first) unique best alignment was found
+  else {
+    my $cpg_ot = my $cpg_ctot = my $cpg_ctob = my $cpg_ob = $output_filename;
+
+    ### For cytosines in CpG context
+    $cpg_ot =~ s/^/CpG_OT_/;
+    $cpg_ot =~ s/sam$/txt/;
+    $cpg_ot =~ s/bam$/txt/;
+    $cpg_ot =~ s/$/.txt/ unless ($cpg_ot =~ /\.txt$/);
+    $cpg_ot = $output_dir . $cpg_ot;
+
+    if ($gzip){
+      $cpg_ot .= '.gz';
+      open ($fhs{0}->{CpG},"| gzip -c - > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{0}->{CpG},"| cat > $cpg_ot") or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+      # open ($fhs{0}->{CpG},'>',$cpg_ot) or die "Failed to write to $cpg_ot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the original top strand to $cpg_ot\n" unless($mbias_only);
+    push @sorting_files,$cpg_ot;
+
+    unless($no_header){
+      print {$fhs{0}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ctot =~ s/^/CpG_CTOT_/;
+    $cpg_ctot =~ s/sam$/txt/;
+    $cpg_ctot =~ s/bam$/txt/;
+    $cpg_ctot =~ s/$/.txt/ unless ($cpg_ctot =~ /\.txt$/);
+    $cpg_ctot = $output_dir . $cpg_ctot;
+
+    if ($gzip){
+      $cpg_ctot .= '.gz';
+      open ($fhs{1}->{CpG},"| gzip -c - > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{1}->{CpG},"| cat > $cpg_ctot") or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+      # open ($fhs{1}->{CpG},'>',$cpg_ctot) or die "Failed to write to $cpg_ctot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the complementary to original top strand to $cpg_ctot\n" unless($mbias_only);
+    push @sorting_files,$cpg_ctot;
+
+    unless($no_header){
+      print {$fhs{1}->{CpG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ctob =~ s/^/CpG_CTOB_/;
+    $cpg_ctob =~ s/sam$/txt/;
+    $cpg_ctob =~ s/bam$/txt/;
+    $cpg_ctob =~ s/$/.txt/ unless ($cpg_ctob =~ /\.txt$/);
+    $cpg_ctob = $output_dir . $cpg_ctob;
+
+    if ($gzip){
+      $cpg_ctob .= '.gz';
+      open ($fhs{2}->{CpG},"| gzip -c - > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{2}->{CpG},"| cat > $cpg_ctob") or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+      # open ($fhs{2}->{CpG},'>',$cpg_ctob) or die "Failed to write to $cpg_ctob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the complementary to original bottom strand to $cpg_ctob\n" unless($mbias_only);
+    push @sorting_files,$cpg_ctob;
+
+    unless($no_header){
+      print {$fhs{2}->{CpG}}  "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $cpg_ob =~ s/^/CpG_OB_/;
+    $cpg_ob =~ s/sam$/txt/;
+    $cpg_ob =~ s/bam$/txt/;
+    $cpg_ob =~ s/$/.txt/ unless ($cpg_ob =~ /\.txt$/);
+    $cpg_ob = $output_dir . $cpg_ob;
+
+    if ($gzip){
+      $cpg_ob .= '.gz';
+      open ($fhs{3}->{CpG},"| gzip -c - > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{3}->{CpG},"| cat > $cpg_ob") or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+      # open ($fhs{3}->{CpG},'>',$cpg_ob) or die "Failed to write to $cpg_ob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CpG context from the original bottom strand to $cpg_ob\n\n" unless($mbias_only);
+    push @sorting_files,$cpg_ob;
+
+    unless($no_header){
+      print {$fhs{3}->{CpG}}  "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### For cytosines in CHG context
+    my $chg_ot = my $chg_ctot = my $chg_ctob = my $chg_ob = $output_filename;
+
+    $chg_ot =~ s/^/CHG_OT_/;
+    $chg_ot =~ s/sam$/txt/;
+    $chg_ot =~ s/bam$/txt/;
+    $chg_ot =~ s/$/.txt/ unless ($chg_ot =~ /\.txt$/);
+    $chg_ot = $output_dir . $chg_ot;
+
+    if ($gzip){
+      $chg_ot .= '.gz';
+      open ($fhs{0}->{CHG},"| gzip -c - > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{0}->{CHG},"| cat > $chg_ot") or die "Failed to write to $chg_ot $!\n" unless($mbias_only);
+      # open ($fhs{0}->{CHG},'>',$chg_ot) or die "Failed to write to $chg_ot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHG context from the original top strand to $chg_ot\n" unless($mbias_only);
+    push @sorting_files,$chg_ot;
+
+    unless($no_header){
+      print {$fhs{0}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chg_ctot =~ s/^/CHG_CTOT_/;
+    $chg_ctot =~ s/sam$/txt/;
+    $chg_ctot =~ s/bam$/txt/;
+    $chg_ctot =~ s/$/.txt/ unless ($chg_ctot =~ /\.txt$/);
+    $chg_ctot = $output_dir . $chg_ctot;
+
+    if ($gzip){
+      $chg_ctot .= '.gz';
+      open ($fhs{1}->{CHG},"| gzip -c - > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{1}->{CHG},"| cat > $chg_ctot") or die "Failed to write to $chg_ctot $!\n" unless($mbias_only);
+      # open ($fhs{1}->{CHG},'>',$chg_ctot) or die "Failed to write to $chg_ctot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHG context from the complementary to original top strand to $chg_ctot\n" unless($mbias_only);
+    push @sorting_files,$chg_ctot;
+
+    unless($no_header){
+      print {$fhs{1}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chg_ctob =~ s/^/CHG_CTOB_/;
+    $chg_ctob =~ s/sam$/txt/;
+    $chg_ctob =~ s/bam$/txt/;
+    $chg_ctob =~ s/$/.txt/ unless ($chg_ctob =~ /\.txt$/);
+    $chg_ctob = $output_dir . $chg_ctob;
+
+    if ($gzip){
+      $chg_ctob .= '.gz';
+      open ($fhs{2}->{CHG},"| gzip -c - > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{2}->{CHG},"| cat > $chg_ctob") or die "Failed to write to $chg_ctob $!\n" unless($mbias_only);
+      # open ($fhs{2}->{CHG},'>',$chg_ctob) or die "Failed to write to $chg_ctob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHG context from the complementary to original bottom strand to $chg_ctob\n" unless($mbias_only);
+    push @sorting_files,$chg_ctob;
+
+    unless($no_header){
+      print {$fhs{2}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chg_ob =~ s/^/CHG_OB_/;
+    $chg_ob =~ s/sam$/txt/;
+    $chg_ob =~ s/bam$/txt/;
+    $chg_ob =~ s/$/.txt/ unless ($chg_ob =~ /\.txt$/);
+    $chg_ob = $output_dir . $chg_ob;
+
+    if ($gzip){
+      $chg_ob .= '.gz';
+      open ($fhs{3}->{CHG},"| gzip -c - > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{3}->{CHG},"| cat > $chg_ob") or die "Failed to write to $chg_ob $!\n" unless($mbias_only);
+      # open ($fhs{3}->{CHG},'>',$chg_ob) or die "Failed to write to $chg_ob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHG context from the original bottom strand to $chg_ob\n\n" unless($mbias_only);
+    push @sorting_files,$chg_ob;
+
+    unless($no_header){
+      print {$fhs{3}->{CHG}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    ### For cytosines in CHH context
+    my $chh_ot = my $chh_ctot = my $chh_ctob = my $chh_ob = $output_filename;
+
+    $chh_ot =~ s/^/CHH_OT_/;
+    $chh_ot =~ s/sam$/txt/;
+    $chh_ot =~ s/bam$/txt/;
+    $chh_ot =~ s/$/.txt/ unless ($chh_ot =~ /\.txt$/);
+    $chh_ot = $output_dir . $chh_ot;
+
+    if ($gzip){
+      $chh_ot .= '.gz';
+      open ($fhs{0}->{CHH},"| gzip -c - > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{0}->{CHH},"| cat > $chh_ot") or die "Failed to write to $chh_ot $!\n" unless($mbias_only);
+      # open ($fhs{0}->{CHH},'>',$chh_ot) or die "Failed to write to $chh_ot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHH context from the original top strand to $chh_ot\n" unless($mbias_only);
+    push @sorting_files,$chh_ot;
+
+    unless($no_header){
+      print {$fhs{0}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chh_ctot =~ s/^/CHH_CTOT_/;
+    $chh_ctot =~ s/sam$/txt/;
+    $chh_ctot =~ s/bam$/txt/;
+    $chh_ctot =~ s/$/.txt/ unless ($chh_ctot =~ /\.txt$/);
+    $chh_ctot = $output_dir . $chh_ctot;
+
+    if ($gzip){
+      $chh_ctot .= '.gz';
+      open ($fhs{1}->{CHH},"| gzip -c - > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{1}->{CHH},"| cat > $chh_ctot") or die "Failed to write to $chh_ctot $!\n" unless($mbias_only);
+      # open ($fhs{1}->{CHH},'>',$chh_ctot) or die "Failed to write to $chh_ctot $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHH context from the complementary to original top strand to $chh_ctot\n" unless($mbias_only);
+    push @sorting_files,$chh_ctot;
+
+    unless($no_header){
+      print {$fhs{1}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chh_ctob =~ s/^/CHH_CTOB_/;
+    $chh_ctob =~ s/sam$/txt/;
+    $chh_ctob =~ s/bam$/txt/;
+    $chh_ctob =~ s/$/.txt/ unless ($chh_ctob =~ /\.txt$/);
+    $chh_ctob = $output_dir . $chh_ctob;
+
+    if ($gzip){
+      $chh_ctob .= '.gz';
+      open ($fhs{2}->{CHH},"| gzip -c - > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{2}->{CHH},"| cat > $chh_ctob") or die "Failed to write to $chh_ctob $!\n" unless($mbias_only);
+      # open ($fhs{2}->{CHH},'>',$chh_ctob) or die "Failed to write to $chh_ctob $!\n" unless($mbias_only);
+    }
+
+    warn "Writing result file containing methylation information for C in CHH context from the complementary to original bottom strand to $chh_ctob\n" unless($mbias_only);
+    push @sorting_files,$chh_ctob;
+
+    unless($no_header){
+      print {$fhs{2}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+
+    $chh_ob =~ s/^/CHH_OB_/;
+    $chh_ob =~ s/sam$/txt/;
+    $chh_ob =~ s/bam$/txt/;
+    $chh_ob =~ s/$/.txt/ unless ($chh_ob =~ /\.txt$/);
+    $chh_ob = $output_dir . $chh_ob;
+
+    if ($gzip){
+      $chh_ob .= '.gz';
+      open ($fhs{3}->{CHH},"| gzip -c - > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only);
+    }
+    else{
+      open ($fhs{3}->{CHH},"| cat > $chh_ob") or die "Failed to write to $chh_ob $!\n" unless($mbias_only);
+      # open ($fhs{3}->{CHH},'>',$chh_ob) or die "Failed to write to $chh_ob $!\n" unless($mbias_only);
+   }
+
+    warn "Writing result file containing methylation information for C in CHH context from the original bottom strand to $chh_ob\n\n" unless($mbias_only);
+    push @sorting_files,$chh_ob;
+
+    unless($no_header){
+      print {$fhs{3}->{CHH}} "Bismark methylation extractor version $version\n" unless($mbias_only);
+    }
+  }
+  return $report_filename;
+}
+
+sub isBam{
+
+  my $filename = shift;
+
+  # reading the first line of the input file to see if it is a BAM file in disguise (i.e. a BAM file that does not end in *.bam which may be produced by Galaxy)
+  open (DISGUISE,"zcat $filename |") or die "Failed to open filehandle DISGUISE for $filename\n\n";
+
+  ### when BAM files read through a zcat stream they start with BAM...
+  my $bam_in_disguise = <DISGUISE>;
+  # warn "BAM in disguise: $bam_in_disguise\n\n";
+
+  if ($bam_in_disguise){
+    if ($bam_in_disguise =~ /^BAM/){
+      close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n";
+      return 1;
+    }
+    else{
+      close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n";
+     return 0;
+    }
+  }
+  else{
+    close (DISGUISE) or warn "Had trouble closing filehandle BAM in disguise: $!\n";
+    return 0;
+  }
+}
+
+
+sub print_helpfile{
+
+ print << 'HOW_TO';
+
+
+DESCRIPTION
+
+The following is a brief description of all options to control the Bismark
+methylation extractor. The script reads in a bisulfite read alignment results file 
+produced by the Bismark bisulfite mapper and extracts the methylation information
+for individual cytosines. This information is found in the methylation call field
+which can contain the following characters:
+
+       ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+       ~~~   X   for methylated C in CHG context                      ~~~
+       ~~~   x   for not methylated C CHG                             ~~~
+       ~~~   H   for methylated C in CHH context                      ~~~
+       ~~~   h   for not methylated C in CHH context                  ~~~
+       ~~~   Z   for methylated C in CpG context                      ~~~
+       ~~~   z   for not methylated C in CpG context                  ~~~
+       ~~~   U   for methylated C in Unknown context (CN or CHN       ~~~
+       ~~~   u   for not methylated C in Unknown context (CN or CHN)  ~~~
+       ~~~   .   for any bases not involving cytosines                ~~~
+       ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+The methylation extractor outputs result files for cytosines in CpG, CHG and CHH
+context (this distinction is actually already made in Bismark itself). As the methylation
+information for every C analysed can produce files which easily have tens or even hundreds of
+millions of lines, file sizes can become very large and more difficult to handle. The C
+methylation info additionally splits cytosine methylation calls up into one of the four possible
+strands a given bisulfite read aligned against:
+
+             OT      original top strand
+             CTOT    complementary to original top strand
+
+             OB      original bottom strand
+             CTOB    complementary to original bottom strand
+
+Thus, by default twelve individual output files are being generated per input file (unless
+--comprehensive is specified, see below). The output files can be imported into a genome
+viewer, such as SeqMonk, and re-combined into a single data group if desired (in fact
+unless the bisulfite reads were generated preserving directionality it doesn't make any
+sense to look at the data in a strand-specific manner). Strand-specific output files can
+optionally be skipped, in which case only three output files for CpG, CHG or CHH context
+will be generated. For both the strand-specific and comprehensive outputs there is also
+the option to merge both non-CpG contexts (CHG and CHH) into one single non-CpG context.
+
+
+The output files are in the following format (tab delimited):
+
+<sequence_id>     <strand>      <chromosome>     <position>     <methylation call>
+
+
+USAGE: methylation_extractor [options] <filenames>
+
+
+ARGUMENTS:
+==========
+
+<filenames>              A space-separated list of Bismark result files in SAM format from
+                         which methylation information is extracted for every cytosine in
+                         the reads. For alignment files in the older custom Bismark output
+                         see option '--vanilla'.
+
+OPTIONS:
+
+-s/--single-end          Input file(s) are Bismark result file(s) generated from single-end
+                         read data. Specifying either --single-end or --paired-end is
+                         mandatory.
+
+-p/--paired-end          Input file(s) are Bismark result file(s) generated from paired-end
+                         read data. Specifying either --paired-end or --single-end is
+                         mandatory.
+
+--vanilla                The Bismark result input file(s) are in the old custom Bismark format
+                         (up to version 0.5.x) and not in SAM format which is the default as
+                         of Bismark version 0.6.x or higher. Default: OFF.
+
+--no_overlap             For paired-end reads it is theoretically possible that read_1 and
+                         read_2 overlap. This option avoids scoring overlapping methylation
+                         calls twice (only methylation calls of read 1 are used for in the process
+                         since read 1 has historically higher quality basecalls than read 2).
+                         Whilst this option removes a bias towards more methylation calls
+                         in the center of sequenced fragments it may de facto remove a sizable
+                         proportion of the data. This option is on by default for paired-end data
+                         but can be disabled using --include_overlap. Default: ON.
+
+--include_overlap        For paired-end data all methylation calls will be extracted irrespective of
+                         of whether they overlap or not. Default: OFF.
+
+--ignore <int>           Ignore the first <int> bp from the 5' end of Read 1 (or single-end alignment
+                         files) when processing the methylation call string. This can remove e.g. a
+                         restriction enzyme site at the start of each read or any other source of
+                         bias (such as PBAT-Seq data).
+
+--ignore_r2 <int>        Ignore the first <int> bp from the 5' end of Read 2 of paired-end sequencing
+                         results only. Since the first couple of bases in Read 2 of BS-Seq experiments
+                         show a severe bias towards non-methylation as a result of end-repairing
+                         sonicated fragments with unmethylated cytosines (see M-bias plot), it is
+                         recommended that the first couple of bp of Read 2 are removed before
+                         starting downstream analysis. Please see the section on M-bias plots in the
+                         Bismark User Guide for more details.
+
+--ignore_3prime <int>    Ignore the last <int> bp from the 3' end of Read 1 (or single-end alignment
+                         files) when processing the methylation call string. This can remove unwanted
+                         biases from the end of reads.
+
+--ignore_3prime_r2 <int> Ignore the last <int> bp from the 3' end of Read 2 of paired-end sequencing
+                         results only. This can remove unwanted biases from the end of reads.
+
+--comprehensive          Specifying this option will merge all four possible strand-specific
+                         methylation info into context-dependent output files. The default
+
+                         contexts are:
+                          - CpG context
+                          - CHG context
+                          - CHH context
+
+--merge_non_CpG          This will produce two output files (in --comprehensive mode) or eight
+                         strand-specific output files (default) for Cs in
+                          - CpG context
+                          - non-CpG context
+
+--report                 Prints out a short methylation summary as well as the paramaters used to run
+                         this script. Default: ON.
+
+--no_header              Suppresses the Bismark version header line in all output files for more convenient
+                         batch processing.
+
+-o/--output DIR          Allows specification of a different output directory (absolute or relative
+                         path). If not specified explicitely, the output will be written to the current directory.
+
+--samtools_path          The path to your Samtools installation, e.g. /home/user/samtools/. Does not need to be specified
+                         explicitly if Samtools is in the PATH already.
+
+--gzip                   The methylation extractor files (CpG_OT_..., CpG_OB_... etc) will be written out in
+                         a GZIP compressed form to save disk space. This option does not work on bedGraph and
+                         genome-wide cytosine reports as they are 'tiny' anyway.
+
+--version                Displays version information.
+
+-h/--help                Displays this help file and exits.
+
+--mbias_only             The methylation extractor will read the entire file but only output the M-bias table and plots as 
+                         well as a report (optional) and then quit. Default: OFF.
+
+--mbias_off              The methylation extractor will process the entire file as usual but doesn't write out any M-bias report.
+                         Only recommended for users who deliberately want to keep an earlier version of the M-bias report. 
+                         Default: OFF.
+
+--multicore <int>        Sets the number of cores to be used for the methylation extraction process. If system resources
+                         are plentiful this is a viable option to speed up the extraction process (we observed a near linear
+                         speed increase for up to 10 cores used). Please note that a typical process of extracting a BAM file
+                         and writing out '.gz' output streams will in fact use ~3 cores per value of --multicore <int>
+                         specified (1 for the methylation extractor itself, 1 for a Samtools stream, 1 for GZIP stream), so
+                         --multicore 10 is likely to use around 30 cores of system resources. This option has no bearing
+                         on the bismark2bedGraph or genome-wide cytosine report processes.
+
+
+
+
+bedGraph specific options:
+==========================
+
+--bedGraph               After finishing the methylation extraction, the methylation output is written into a
+                         sorted bedGraph file that reports the position of a given cytosine and its methylation 
+                         state (in %, see details below). The methylation extractor output is temporarily split up into
+                         temporary files, one per chromosome (written into the current directory or folder
+                         specified with -o/--output); these temp files are then used for sorting and deleted
+                         afterwards. By default, only cytosines in CpG context will be sorted. The option
+                         '--CX_context' may be used to report all cytosines irrespective of sequence context
+                         (this will take MUCH longer!). The default folder for temporary files during the sorting
+                         process is the output directory. The bedGraph conversion step is performed by the external
+                         module 'bismark2bedGraph'; this script needs to reside in the same folder as the 
+                         bismark_methylation_extractor itself.
+
+--zero_based             Write out an additional coverage file (ending in .zero.cov) that uses 0-based genomic start
+                         and 1-based genomic end coordinates (zero-based, half-open), like used in the bedGraph file,
+                         instead of using 1-based coordinates throughout. Default: OFF.
+
+
+--cutoff [threshold]     The minimum number of times a methylation state has to be seen for that nucleotide
+                         before its methylation percentage is reported. Default: 1.
+
+--remove_spaces          Replaces whitespaces in the sequence ID field with underscores to allow sorting.
+
+--CX/--CX_context        The sorted bedGraph output file contains information on every single cytosine that was covered
+                         in the experiment irrespective of its sequence context. This applies to both forward and
+                         reverse strands. Please be aware that this option may generate large temporary and output files
+                         and may take a long time to sort (up to many hours). Default: OFF.
+                         (i.e. Default = CpG context only).
+
+--buffer_size <string>   This allows you to specify the main memory sort buffer when sorting the methylation information.
+                         Either specify a percentage of physical memory by appending % (e.g. --buffer_size 50%) or
+			 a multiple of 1024 bytes, e.g. 'K' multiplies by 1024, 'M' by 1048576 and so on for 'T' etc. 
+                         (e.g. --buffer_size 20G). For more information on sort type 'info sort' on a command line.
+                         Defaults to 2G.
+
+--scaffolds/--gazillion  Users working with unfinished genomes sporting tens or even hundreds of thousands of
+                         scaffolds/contigs/chromosomes frequently encountered errors with pre-sorting reads to
+                         individual chromosome files. These errors were caused by the operating system's limit
+                         of the number of filehandle that can be written to at any one time (typically 1024; to
+                         find out this limit on Linux, type: ulimit -a).
+                         To bypass the limitation of open filehandles, the option --scaffolds does not pre-sort
+                         methylation calls into individual chromosome files. Instead, all input files are
+                         temporarily merged into a single file (unless there is only a single file), and this
+                         file will then be sorted by both chromosome AND position using the Unix sort command.
+                         Please be aware that this option might take a looooong time to complete, depending on
+                         the size of the input files, and the memory you allocate to this process (see --buffer_size).
+                         Nevertheless, it seems to be working.
+
+--ample_memory           Using this option will not sort chromosomal positions using the UNIX 'sort' command, but will
+                         instead use two arrays to sort methylated and unmethylated calls. This may result in a faster
+                         sorting process of very large files, but this comes at the cost of a larger memory footprint
+                         (two arrays of the length of the largest human chromosome 1 (~250M bp) consume around 16GB
+                         of RAM). Due to overheads in creating and looping through these arrays it seems that it will
+                         actually be *slower* for small files (few million alignments), and we are currently testing at
+                         which point it is advisable to use this option. Note that --ample_memory is not compatible
+                         with options '--scaffolds/--gazillion' (as it requires pre-sorted files to begin with).
+
+
+
+Genome-wide cytosine methylation report specific options:
+=========================================================
+
+--cytosine_report        After the conversion to bedGraph has completed, the option '--cytosine_report' produces a
+                         genome-wide methylation report for all cytosines in the genome. By default, the output uses 1-based
+                         chromosome coordinates (zero-based start coords are optional) and reports CpG context only (all
+                         cytosine context is optional). The output considers all Cs on both forward and reverse strands and
+                         reports their position, strand, trinucleotide content and methylation state (counts are 0 if not
+                         covered). The cytosine report conversion step is performed by the external module
+                         'coverage2cytosine'; this script needs to reside in the same folder as the bismark_methylation_extractor
+                         itself.
+
+--CX/--CX_context        The output file contains information on every single cytosine in the genome irrespective of
+                         its context. This applies to both forward and reverse strands. Please be aware that this will
+                         generate output files with > 1.1 billion lines for a mammalian genome such as human or mouse.
+                         Default: OFF (i.e. Default = CpG context only).
+
+--zero_based             Uses 0-based genomic coordinates instead of 1-based coordinates. Default: OFF.
+
+--genome_folder <path>   Enter the genome folder you wish to use to extract sequences from (full path only). Accepted
+                         formats are FastA files ending with '.fa' or '.fasta'. Specifying a genome folder path is mandatory.
+
+--split_by_chromosome    Writes the output into individual files for each chromosome instead of a single output file. Files
+                         will be named to include the input filename and the chromosome number.
+
+
+
+OUTPUT:
+
+The bismark_methylation_extractor output is in the form:
+========================================================
+<seq-ID>  <methylation state*>  <chromosome>  <start position (= end position)>  <methylation call>
+
+* Methylated cytosines receive a '+' orientation,
+* Unmethylated cytosines receive a '-' orientation.
+
+
+
+The bedGraph output (optional) looks like this (tab-delimited; 0-based start coords, 1-based end coords):
+=========================================================================================================
+
+track type=bedGraph (header line)
+
+<chromosome>  <start position>  <end position>  <methylation percentage>
+
+
+
+The coverage output looks like this (tab-delimited, 1-based genomic coords; zero-based half-open coordinates available with '--zero_based'):
+============================================================================================================================================
+
+<chromosome>  <start position>  <end position>  <methylation percentage>  <count methylated>  <count non-methylated>
+
+
+
+The genome-wide cytosine methylation output file is tab-delimited in the following format:
+==========================================================================================
+<chromosome>  <position>  <strand>  <count methylated>  <count non-methylated>  <C-context>  <trinucleotide context>
+
+
+
+This script was last modified on 22 April 2015.
+
+HOW_TO
+}