Mercurial > repos > bgruening > bismark

changeset 14:b6aa3b6ba129 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/bismark commit f57cd875407ce987c4897fc352c5db0eeb8e9efe
author bgruening
date Tue, 30 Jul 2019 10:33:02 -0400
parents f211753166bd
children 0b656f8c5637
files bismark_bowtie2_wrapper.xml test-data/mapped_reads_mate.bam test-data/mapping_report_mate.txt test-data/summary_mate.txt
diffstat 4 files changed, 581 insertions(+), 9 deletions(-) [+]
line wrap: on
line diff
--- a/bismark_bowtie2_wrapper.xml	Tue Jul 30 06:30:36 2019 -0400
+++ b/bismark_bowtie2_wrapper.xml	Tue Jul 30 10:33:02 2019 -0400
@@ -1,4 +1,4 @@
-<tool id="bismark_bowtie2" name="Bismark Mapper" version="0.22.1" profile="18.01">
+<tool id="bismark_bowtie2" name="Bismark Mapper" version="0.22.1+galaxy1" profile="18.01">
     <description>Bisulfite reads mapper</description>
     <requirements>
         <requirement type="package" version="0.22.1">bismark</requirement>
@@ -6,6 +6,8 @@
         <requirement type="package" version="2.3.5">bowtie2</requirement>
     </requirements>
     <command><![CDATA[
+        #import re
+
         #if $singlePaired.sPaired == "single":
             #if $singlePaired.input_singles.ext == "fasta":
                 #set read1 = 'input_1.fa'
@@ -19,26 +21,27 @@
             #set $mate1 = list()
             #set $mate2 = list()
             #for $mate_pair in $singlePaired.mate_list
-                $mate1.append( str($mate_pair.input_mate1) )
-                $mate2.append( str($mate_pair.input_mate2) )
 
                 #if $mate_pair.input_mate1.ext == "fasta":
-                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_1.fa'
+                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_1.fa'
                 #elif $mate_pair.input_mate1.ext in ["fastq.gz", "fastqsanger.gz"]:
-                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_1.fq.gz'
+                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_1.fq.gz'
                 #else
-                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_1.fq'
+                    #set read1 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_1.fq'
                 #end if
                 ln -s '${mate_pair.input_mate1}' ${read1} &&
 
                 #if $mate_pair.input_mate2.ext == "fasta":
-                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_2.fa'
+                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_2.fa'
                 #elif $mate_pair.input_mate2.ext in ["fastq.gz", "fastqsanger.gz"]:
-                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_2.fq.gz'
+                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_2.fq.gz'
                 #else
-                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1)) + '_2.fq'
+                    #set read2 = re.sub('[^\s\w\-]', '_', str($mate_pair.input_mate1.element_identifier)) + '_2.fq'
                 #end if
                 ln -s '${mate_pair.input_mate2}' ${read2} &&
+
+                $mate1.append( str($read1) )
+                $mate2.append( str($read2) )
             #end for
         #end if
 
@@ -481,6 +484,33 @@
             <output name="report_file" file="mapping_report_short.txt" ftype="txt" lines_diff="6"/>
             <output name="output" file="mapped_reads_short.bam" ftype="qname_input_sorted.bam" lines_diff="14"/>
         </test>
+        <test>
+            <param name="genomeSource" value="history"/>
+            <param name="own_file" value="mm10.tiny.fa.gz" />
+            <param name="sPaired" value="paired"/>
+            <repeat name="mate_list">
+                <param name="input_mate1" value="input1.fq" ftype="fastqsanger"/>
+                <param name="input_mate2" value="input1.fq" ftype="fastqsanger"/>
+            </repeat>
+            <param name="sort_bam" value="false"/>
+            <param name="settingsType" value="custom"/>
+            <param name="suppressed_read_file" value="true"/>
+            <param name="unmapped_read_file" value="true"/>
+            <param name="bismark_stdout" value="true"/>
+            <param name="isReportOutput" value="true"/>
+
+            <output name="output_stdout" file="summary_mate.txt" ftype="txt" lines_diff="80">
+                 <assert_contents>
+                     <has_text text="Sequence pairs analysed in total:" />
+                     <has_text text="1000" />
+                     <has_text text="Mapping efficiency:" />
+                     <has_text text="0.0%" />
+                     <has_text text="Bismark run complete" />
+                 </assert_contents>
+            </output>
+            <output name="report_file" file="mapping_report_mate.txt" ftype="txt" lines_diff="6"/>
+            <output name="output" file="mapped_reads_mate.bam" ftype="qname_input_sorted.bam" lines_diff="14"/>
+        </test>
     </tests>
 
     <help>
Binary file test-data/mapped_reads_mate.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mapping_report_mate.txt	Tue Jul 30 10:33:02 2019 -0400
@@ -0,0 +1,42 @@
+Bismark report for: input1_fq_1.fq and input1_fq_2.fq (version: v0.22.1)
+Bismark was run with Bowtie 2 against the bisulfite genome of /tmp/tmpAHSx4i/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+Option '--directional' specified (default mode): alignments to complementary strands (CTOT, CTOB) were ignored (i.e. not performed)
+
+Final Alignment report
+======================
+Sequence pairs analysed in total:	1000
+Number of paired-end alignments with a unique best hit:	0
+Mapping efficiency:	0.0% 
+Sequence pairs with no alignments under any condition:	1000
+Sequence pairs did not map uniquely:	0
+Sequence pairs which were discarded because genomic sequence could not be extracted:	0
+
+Number of sequence pairs with unique best (first) alignment came from the bowtie output:
+CT/GA/CT:	0	((converted) top strand)
+GA/CT/CT:	0	(complementary to (converted) top strand)
+GA/CT/GA:	0	(complementary to (converted) bottom strand)
+CT/GA/GA:	0	((converted) bottom strand)
+
+Number of alignments to (merely theoretical) complementary strands being rejected in total:	0
+
+Final Cytosine Methylation Report
+=================================
+Total number of C's analysed:	0
+
+Total methylated C's in CpG context:	0
+Total methylated C's in CHG context:	0
+Total methylated C's in CHH context:	0
+Total methylated C's in Unknown context:	0
+
+Total unmethylated C's in CpG context:	0
+Total unmethylated C's in CHG context:	0
+Total unmethylated C's in CHH context:	0
+Total unmethylated C's in Unknown context:	0
+
+Can't determine percentage of methylated Cs in CpG context if value was 0
+Can't determine percentage of methylated Cs in CHG context if value was 0
+Can't determine percentage of methylated Cs in CHH context if value was 0
+Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0
+
+
+Bismark completed in 0d 0h 0m 5s
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/summary_mate.txt	Tue Jul 30 10:33:02 2019 -0400
@@ -0,0 +1,500 @@
+Create a temporary index with the offered files from the user. Utilizing the script: bismark_genome_preparation
+Generating index with: 'bismark_genome_preparation --bowtie2 /tmp/tmpAHSx4i'
+Writing bisulfite genomes out into a single MFA (multi FastA) file
+
+Bisulfite Genome Indexer version v0.22.1 (last modified: 14 April 2019)
+
+Step I - Prepare genome folders - completed
+
+
+
+Total number of conversions performed:
+C->T:	146875
+G->A:	150504
+
+Step II - Genome bisulfite conversions - completed
+
+
+Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer
+Please be aware that this process can - depending on genome size - take several hours!
+Settings:
+  Output files: "BS_CT.*.bt2"
+  Line rate: 6 (line is 64 bytes)
+  Lines per side: 1 (side is 64 bytes)
+  Offset rate: 4 (one in 16)
+  FTable chars: 10
+  Strings: unpacked
+  Max bucket size: default
+  Max bucket size, sqrt multiplier: default
+  Max bucket size, len divisor: 4
+  Difference-cover sample period: 1024
+  Endianness: little
+  Actual local endianness: little
+  Sanity checking: disabled
+  Assertions: disabled
+  Random seed: 0
+  Sizeofs: void*:8, int:4, long:8, size_t:8
+Input files DNA, FASTA:
+  genome_mfa.CT_conversion.fa
+Building a SMALL index
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 235897
+fchr[G]: 235897
+fchr[T]: 386401
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_CT.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_CT.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 0
+Total time for call to driver() for forward index: 00:00:00
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+  Time to reverse reference sequence: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 235897
+fchr[G]: 235897
+fchr[T]: 386401
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_CT.rev.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_CT.rev.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 1
+Total time for backward call to driver() for mirror index: 00:00:01
+Settings:
+  Output files: "BS_GA.*.bt2"
+  Line rate: 6 (line is 64 bytes)
+  Lines per side: 1 (side is 64 bytes)
+  Offset rate: 4 (one in 16)
+  FTable chars: 10
+  Strings: unpacked
+  Max bucket size: default
+  Max bucket size, sqrt multiplier: default
+  Max bucket size, len divisor: 4
+  Difference-cover sample period: 1024
+  Endianness: little
+  Actual local endianness: little
+  Sanity checking: disabled
+  Assertions: disabled
+  Random seed: 0
+  Sizeofs: void*:8, int:4, long:8, size_t:8
+Input files DNA, FASTA:
+  genome_mfa.GA_conversion.fa
+Building a SMALL index
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 386401
+fchr[G]: 533276
+fchr[T]: 533276
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_GA.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_GA.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 0
+Total time for call to driver() for forward index: 00:00:00
+Reading reference sizes
+  Time reading reference sizes: 00:00:00
+Calculating joined length
+Writing header
+Reserving space for joined string
+Joining reference sequences
+  Time to join reference sequences: 00:00:00
+  Time to reverse reference sequence: 00:00:00
+bmax according to bmaxDivN setting: 189039
+Using parameters --bmax 141780 --dcv 1024
+  Doing ahead-of-time memory usage test
+  Passed!  Constructing with these parameters: --bmax 141780 --dcv 1024
+Constructing suffix-array element generator
+Building DifferenceCoverSample
+  Building sPrime
+  Building sPrimeOrder
+  V-Sorting samples
+  V-Sorting samples time: 00:00:00
+  Allocating rank array
+  Ranking v-sort output
+  Ranking v-sort output time: 00:00:00
+  Invoking Larsson-Sadakane on ranks
+  Invoking Larsson-Sadakane on ranks time: 00:00:00
+  Sanity-checking and returning
+Building samples
+Reserving space for 12 sample suffixes
+Generating random suffixes
+QSorting 12 sample offsets, eliminating duplicates
+QSorting sample offsets, eliminating duplicates time: 00:00:00
+Multikey QSorting 12 samples
+  (Using difference cover)
+  Multikey QSorting samples time: 00:00:00
+Calculating bucket sizes
+Splitting and merging
+  Splitting and merging time: 00:00:00
+Avg bucket size: 756159 (target: 141779)
+Converting suffix-array elements to index image
+Allocating ftab, absorbFtab
+Entering Ebwt loop
+Getting block 1 of 1
+  No samples; assembling all-inclusive block
+  Sorting block of length 756159 for bucket 1
+  (Using difference cover)
+  Sorting block time: 00:00:00
+Returning block of 756160 for bucket 1
+Exited Ebwt loop
+fchr[A]: 0
+fchr[C]: 386401
+fchr[G]: 533276
+fchr[T]: 533276
+fchr[$]: 756159
+Exiting Ebwt::buildToDisk()
+Returning from initFromVector
+Wrote 4446745 bytes to primary EBWT file: BS_GA.rev.1.bt2
+Wrote 189044 bytes to secondary EBWT file: BS_GA.rev.2.bt2
+Re-opening _in1 and _in2 as input streams
+Returning from Ebwt constructor
+Headers:
+    len: 756159
+    bwtLen: 756160
+    sz: 189040
+    bwtSz: 189040
+    lineRate: 6
+    offRate: 4
+    offMask: 0xfffffff0
+    ftabChars: 10
+    eftabLen: 20
+    eftabSz: 80
+    ftabLen: 1048577
+    ftabSz: 4194308
+    offsLen: 47260
+    offsSz: 189040
+    lineSz: 64
+    sideSz: 64
+    sideBwtSz: 48
+    sideBwtLen: 192
+    numSides: 3939
+    numLines: 3939
+    ebwtTotLen: 252096
+    ebwtTotSz: 252096
+    color: 0
+    reverse: 1
+Total time for backward call to driver() for mirror index: 00:00:01
+Running bismark with: 'bismark --bam --gzip --temp_dir /tmp/tmp86syD7 -o /tmp/tmp86syD7/results --quiet --fastq -L 20 -D 15 -R 2 --un --ambiguous /tmp/tmpAHSx4i -1 input1_fq_1.fq -2 input1_fq_2.fq -I 0 -X 500'
+Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
+Output format is BAM (default)
+Alignments will be written out in BAM format. Samtools found here: '/home/abretaud/miniconda3/envs/mulled-v1-9f2317dbfb405ed6926c55752e5c11678eee3256a6ea680d1c0f912251153030/bin/samtools'
+Reference genome folder provided is /tmp/tmpAHSx4i/	(absolute path is '/tmp/tmpAHSx4i/)'
+FastQ format specified
+
+Input files to be analysed (in current folder '/tmp/tmpFC2FCZ/job_working_directory/000/4/working'):
+input1_fq_1.fq
+input1_fq_2.fq
+Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
+Created output directory /tmp/tmp86syD7/results/!
+
+Output will be written into the directory: /tmp/tmp86syD7/results/
+
+Using temp directory: /tmp/tmp86syD7
+Temporary files will be written into the directory: /tmp/tmp86syD7/
+Setting parallelization to single-threaded (default)
+
+Summary of all aligner options:	-q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+Current working directory is: /tmp/tmpFC2FCZ/job_working_directory/000/4/working
+
+Now reading in and storing sequence information of the genome specified in: /tmp/tmpAHSx4i/
+
+chr chrY_JH584300_random (182347 bp)
+chr chrY_JH584301_random (259875 bp)
+chr chrY_JH584302_random (155838 bp)
+chr chrY_JH584303_random (158099 bp)
+
+Single-core mode: setting pid to 1
+
+Paired-end alignments will be performed
+=======================================
+
+The provided filenames for paired-end alignments are input1_fq_1.fq and input1_fq_2.fq
+Input files are in FastQ format
+Writing a C -> T converted version of the input file input1_fq_1.fq to /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz
+
+Created C -> T converted version of the FastQ file input1_fq_1.fq (1000 sequences in total)
+
+Writing a G -> A converted version of the input file input1_fq_2.fq to /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz
+
+Created G -> A converted version of the FastQ file input1_fq_2.fq (1000 sequences in total)
+
+Input files are input1_fq_1.fq_C_to_T.fastq.gz and input1_fq_2.fq_G_to_A.fastq.gz (FastQ)
+Now running 2 instances of Bowtie 2 against the bisulfite genome of /tmp/tmpAHSx4i/ with the specified options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet
+
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --norc))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz, with the options: -q -L 20 -D 15 -R 2 --score-min L,0,-0.2 --ignore-quals --no-mixed --no-discordant --dovetail --minins 0 --maxins 500 --quiet --nofw))
+Found first alignment:
+1_1/1	77	*	0	0	*	*	0	0	TTGTATATATTAGATAAATTAATTTTTTTTGTTTGTATGTTAAATTTTTTAATTAATTTATTAATATTTTGTGAATTTTTAGATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+1_1/2	141	*	0	0	*	*	0	0	TTATATATATTAAATAAATTAATTTTTTTTATTTATATATTAAATTTTTTAATTAATTTATTAATATTTTATAAATTTTTAAATA	AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEE	YT:Z:UP
+
+>>> Writing bisulfite mapping results to input1_fq_1_bismark_bt2_pe.bam <<<
+
+Unmapped sequences will be written to input1_fq_1.fq_unmapped_reads_1.fq.gz and input1_fq_2.fq_unmapped_reads_2.fq.gz
+Ambiguously mapping sequences will be written to input1_fq_1.fq_ambiguous_reads_1.fq.gz and input1_fq_2.fq_ambiguous_reads_2.fq.gz
+
+Reading in the sequence files input1_fq_1.fq and input1_fq_2.fq
+Processed 1000 sequences in total
+
+
+Successfully deleted the temporary files /tmp/tmp86syD7/input1_fq_1.fq_C_to_T.fastq.gz and /tmp/tmp86syD7/input1_fq_2.fq_G_to_A.fastq.gz
+
+Final Alignment report
+======================
+Sequence pairs analysed in total:	1000
+Number of paired-end alignments with a unique best hit:	0
+Mapping efficiency:	0.0%
+
+Sequence pairs with no alignments under any condition:	1000
+Sequence pairs did not map uniquely:	0
+Sequence pairs which were discarded because genomic sequence could not be extracted:	0
+
+Number of sequence pairs with unique best (first) alignment came from the bowtie output:
+CT/GA/CT:	0	((converted) top strand)
+GA/CT/CT:	0	(complementary to (converted) top strand)
+GA/CT/GA:	0	(complementary to (converted) bottom strand)
+CT/GA/GA:	0	((converted) bottom strand)
+
+Number of alignments to (merely theoretical) complementary strands being rejected in total:	0
+
+Final Cytosine Methylation Report
+=================================
+Total number of C's analysed:	0
+
+Total methylated C's in CpG context:	0
+Total methylated C's in CHG context:	0
+Total methylated C's in CHH context:	0
+Total methylated C's in Unknown context:	0
+
+Total unmethylated C's in CpG context:	0
+Total unmethylated C's in CHG context:	0
+Total unmethylated C's in CHH context:	0
+Total unmethylated C's in Unknown context:	0
+
+Can't determine percentage of methylated Cs in CpG context if value was 0
+Can't determine percentage of methylated Cs in CHG context if value was 0
+Can't determine percentage of methylated Cs in CHH context if value was 0
+Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0
+
+
+Bismark completed in 0d 0h 0m 5s
+
+====================
+Bismark run complete
+====================
+