Mercurial > repos > bgruening > glimmer_build_icm
view glimmer_build_icm.xml @ 0:9c195b26a5ac draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
author | bgruening |
---|---|
date | Tue, 28 Nov 2017 10:08:06 -0500 |
parents | |
children | cc51783dc93c |
line wrap: on
line source
<tool id="glimmer_build_icm" name="Glimmer ICM builder" version="@WRAPPER_VERSION@"> <description></description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements"/> <command><![CDATA[ build-icm --depth $depth $no_stops --period $period --width $width #if $stop_codon_opts.stop_codon_opts_selector == "gb": --trans_table '${stop_codon_opts.genbank_gencode}' #else: --stop_codons '${stop_codon_opts.stop_codons}' #end if '$outfile' < '$infile' 2>&1; ]]></command> <inputs> <param name="infile" type="data" format="fasta" label="Trainings Dataset" help="A set of known genes in FASTA format." /> <param name="depth" type="integer" value="7" label="Set the depth of the ICM" help="The depth is the maximum number of positions in the context window that will be used to determine the probability of the predicted position." /> <param name="period" type="integer" value="3" label="Set the period of the ICM" help="The period is the number of different submodels for different positions in the text in a cyclic pattern. E.g., if the period is 3, the first submodel will determine positions 1, 4, 7, ..." /> <param name="width" type="integer" value="12" label="Set the width of the ICM" help="The width includes the predicted position." /> <param name="no_stops" type="boolean" truevalue="--no_stops" falsevalue="" checked="false" label="Do not use any input strings with in-frame stop codons" /> <conditional name="stop_codon_opts"> <param name="stop_codon_opts_selector" type="select" label="Specify start codons as"> <option value="gb" selected="True">Genbank translation table entry</option> <option value="free_form">Comma-separated list</option> </param> <when value="gb"> <param name="genbank_gencode" type="select" label="Use Genbank translation table to specify stop codons"> <option value="1" selected="True">1. Standard</option> <option value="2">2. Vertebrate Mitochondrial</option> <option value="3">3. Yeast Mitochondrial</option> <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option> <option value="5">5. Invertebrate Mitochondrial</option> <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option> <option value="9">9. Echinoderm Mitochondrial</option> <option value="10">10. Euplotid Nuclear</option> <option value="11">11. Bacteria and Archaea</option> <option value="12">12. Alternative Yeast Nuclear</option> <option value="13">13. Ascidian Mitochondrial</option> <option value="14">14. Flatworm Mitochondrial</option> <option value="15">15. Blepharisma Macronuclear</option> <option value="16">16. Chlorophycean Mitochondrial</option> <option value="21">21. Trematode Mitochondrial</option> <option value="22">22. Scenedesmus obliquus mitochondrial</option> <option value="23">23. Thraustochytrium Mitochondrial</option> <option value="24">24. Pterobranchia mitochondrial</option> </param> </when> <when value="free_form"> <param name="stop_codons" type="text" value="tag,tga,taa" label="Specify stop codons as a comma-separated list" /> </when> </conditional> </inputs> <outputs> <data format="data" name="outfile" /> </outputs> <tests> <test> <param name="infile" value='streptomyces_Tu6071_plasmid_genes.fasta' /> <param name="depth" value="7" /> <param name="period" value="3" /> <param name="width" value="12" /> <param name="no_stops" value="" /> <param name="genbank_gencode" value="11" /> <!-- compare files sizes, because the output is a binary --> <output name="outfile" file='streptomyces_Tu6071_plasmid_genes.icm' compare="sim_size" delta="1000" ftype="data" /> </test> </tests> <help> <![CDATA[ **What it does** This program constructs an interpolated context model (ICM) from an input set of sequences. This model can be used by Glimmer3 to predict genes. **TIP** To extract CDS from a GenBank file use the tool *Extract ORF from a GenBank file*. ----- **Example** *Input*:: - Genome Sequence >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT ..... *Output*:: interpolated context model (ICM) ]]> </help> <expand macro="citation" /> </tool>