infernal: cmbuild.xml annotate

annotate cmbuild.xml @ 9:1d74ed49cf41 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e

author	bgruening
date	Mon, 11 Nov 2024 10:27:19 +0000
parents	c9e29ac5d099
children

rev	line source
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	1 <tool id="infernal_cmbuild" name="cmbuild" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	2 <description>Build covariance models from sequence alignments</description>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	3 <macros>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	4 <import>macros.xml</import>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	5 </macros>
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	6 <!--parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism-->
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	7 <expand macro="xrefs"/>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	8 <expand macro="requirements" />
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	9 <expand macro="stdio" />
0 652f9d550531 Uploaded bgruening parents: diff changeset	10 <command>
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	11 <![CDATA[
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	12 cmbuild
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	13 -F
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	14 #if $is_summery_output:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	15 -o '$summary_outfile'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	16 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	17 ## to many outputs, is that one really needed?
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	18 ##-O $annotated_source_alignment_outfile
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	19 $model_construction_opts.model_construction_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	20 #if $model_construction_opts.model_construction_opts_selector == '--fast':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	21 --symfrac $model_construction_opts.symfrac
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	22 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	23 $noss
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	24 $relative_weights_opts.relative_weights_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	25 #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	26 --wid $relative_weights_opts.wid
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	27 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	28 --p7ere $controlling_filter_p7_hmm.p7ere
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	29 $controlling_filter_p7_hmm.p7ml
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	30 --EmN $controlling_filter_p7_hmm.EmN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	31 --EvN $controlling_filter_p7_hmm.EvN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	32 --ElfN $controlling_filter_p7_hmm.ElfN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	33 --EgfN $controlling_filter_p7_hmm.EgfN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	34 $effective_opts.effective_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	35 #if str($effective_opts.effective_opts_selector) == '--eent':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	36 #if $effective_opts.ere
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	37 --ere $effective_opts.ere
0 652f9d550531 Uploaded bgruening parents: diff changeset	38 #end if
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	39 #if $effective_opts.eminseq
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	40 --eminseq $effective_opts.eminseq
0 652f9d550531 Uploaded bgruening parents: diff changeset	41 #end if
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	42 #if $effective_opts.emaxseq
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	43 --emaxseq $effective_opts.emaxseq
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	44 #end if
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	45 #if $effective_opts.ehmmre
0 652f9d550531 Uploaded bgruening parents: diff changeset	46 --ehmmre $effective_opts.ehmmre
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	47 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	48 #if $effective_opts.eset
0 652f9d550531 Uploaded bgruening parents: diff changeset	49 --eset $effective_opts.eset
652f9d550531 Uploaded bgruening parents: diff changeset	50 #end if
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	51 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	52 #if str($refining_opts.refining_opts_selector) == '--refine':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	53 #if $refining_opts.refine_output:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	54 --refine '$refined_multiple_alignment_output'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	55 #else:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	56 --refine /dev/null
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	57 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	58 $refining_opts.l
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	59 $refining_opts.gibbs_opts.gibbs_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	60 #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	61 --seed $refining_opts.gibbs_opts.random_seed
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	62 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	63 $refining_opts.notrunc
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	64 $refining_opts.cyk
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	65 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	66 '$cmfile_outfile'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	67 '$alignment_infile'
0 652f9d550531 Uploaded bgruening parents: diff changeset	68
652f9d550531 Uploaded bgruening parents: diff changeset	69
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	70 #if $Calibrate.selector=="true"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	71 && cmcalibrate
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	72 -L $Calibrate.L
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	73 #if $Calibrate.output_options_cond.selector == "extra"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	74 #if str($Calibrate.output_options_cond.output_options) != 'None'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	75 #for j in $Calibrate.output_options_cond.output_options.value:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	76 --$j $getVar($j)
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	77 #end for
0 652f9d550531 Uploaded bgruening parents: diff changeset	78 #end if
652f9d550531 Uploaded bgruening parents: diff changeset	79 #end if
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	80 #if $Calibrate.cont_exp_tails_fits.selector == "top_n"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	81 --gtailn $Calibrate.cont_exp_tails_fits.gtailn
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	82 --ltailn $Calibrate.cont_exp_tails_fits.ltailn
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	83 #elif $Calibrate.cont_exp_tails_fits.selector == "frac"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	84 --tailp $Calibrate.cont_exp_tails_fits.tailp
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	85 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	86 --seed $Calibrate.add_opts.seed
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	87 --beta $Calibrate.add_opts.beta
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	88 $Calibrate.add_opts.nonbanded
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	89 $Calibrate.add_opts.nonull3
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	90 $Calibrate.add_opts.random
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	91 #if str($Calibrate.add_opts.gc) != 'None'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	92 --gc '$Calibrate.add_opts.gc'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	93 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	94 --cpu "\${GALAXY_SLOTS:-2}"
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	95 '$cmfile_outfile'
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	96 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	97
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	98 ]]>
0 652f9d550531 Uploaded bgruening parents: diff changeset	99 </command>
652f9d550531 Uploaded bgruening parents: diff changeset	100 <inputs>
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	101 <param name="alignment_infile" type="data" format="stockholm" label="Sequence database"/>
0 652f9d550531 Uploaded bgruening parents: diff changeset	102
652f9d550531 Uploaded bgruening parents: diff changeset	103 <conditional name="model_construction_opts">
652f9d550531 Uploaded bgruening parents: diff changeset	104 <param name="model_construction_opts_selector" type="select" label="These options control how consensus columns are defined in an alignment" help="">
652f9d550531 Uploaded bgruening parents: diff changeset	105 <option value="--fast" selected="true">automatic (--fast)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	106 <option value="--hand">user defined (--hand)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	107 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	108 <when value="--fast">
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	109 <param name="symfrac" type="float" value="0.5"
0 652f9d550531 Uploaded bgruening parents: diff changeset	110 label="Define the residue fraction threshold necessary to define a consensus (--symfrac)" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	111 </when>
652f9d550531 Uploaded bgruening parents: diff changeset	112 <when value="--hand"/>
652f9d550531 Uploaded bgruening parents: diff changeset	113 </conditional>
652f9d550531 Uploaded bgruening parents: diff changeset	114
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	115 <param name="noss" truevalue="--noss" falsevalue="" checked="False" type="boolean"
0 652f9d550531 Uploaded bgruening parents: diff changeset	116 label="Ignore the secondary structure annotation, if any, in your multiple alignment file (--noss)" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	117
652f9d550531 Uploaded bgruening parents: diff changeset	118 <conditional name="relative_weights_opts">
652f9d550531 Uploaded bgruening parents: diff changeset	119 <param name="relative_weights_opts_selector" type="select" label="Options controlling relative weights" help="">
652f9d550531 Uploaded bgruening parents: diff changeset	120 <option value="--wpb" selected="true">Henikoff (--wgb)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	121 <option value="--wgsc">Gerstein/Sonnhammer/Chothia (--wgsc)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	122 <option value="--wnone">no sequence weighting (--wnone)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	123 <option value="--wgiven">Sequence weight from given in input file (--wgiven)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	124 <option value="--wblosum">BLOSUM filtering algorithm (--wblosum)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	125 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	126 <when value="--wpb"/>
652f9d550531 Uploaded bgruening parents: diff changeset	127 <when value="--wgsc"/>
652f9d550531 Uploaded bgruening parents: diff changeset	128 <when value="--wnone"/>
652f9d550531 Uploaded bgruening parents: diff changeset	129 <when value="--wgiven"/>
652f9d550531 Uploaded bgruening parents: diff changeset	130 <when value="--wblosum">
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	131 <param name="wid" type="float" value="0.5"
0 652f9d550531 Uploaded bgruening parents: diff changeset	132 label="Percent identity for clustering the alignment (--wid)" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	133 </when>
652f9d550531 Uploaded bgruening parents: diff changeset	134 </conditional>
652f9d550531 Uploaded bgruening parents: diff changeset	135
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	136 <section name="controlling_filter_p7_hmm" title="Controlling Filter P7 HMM construction" >
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	137 <param argument="--p7ere" type="float" value="0.38" label="For the filter p7 HMM, set minimum rel entropy/posn to" help="Set the target mean match state relative entropy for the filter p7 HMM"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	138 <param argument="--p7ml" type="boolean" truevalue="--p7ml" falsevalue="" checked="false" label="Define the filter p7 HMM as the ML p7 HMM" help="Use a mzimum likelihood p7 HMM built from the CM as the filter HMM"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	139 <param argument="--EmN" type="integer" value="200" label="Number of sampled seqs to use for p7 local MSV calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	140 <param argument="--EvN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Vit calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	141 <param argument="--ElfN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Fwd calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	142 <param argument="--EgfN" type="integer" value="200" label="Number of sampled seqs to use for p7 glocal Fwd calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	143 </section>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	144
0 652f9d550531 Uploaded bgruening parents: diff changeset	145 <conditional name="effective_opts">
652f9d550531 Uploaded bgruening parents: diff changeset	146 <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help="">
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	147 <option value="--eent" >entropy weighting strategy (--eent)</option>
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	148 <option value="--enone" selected="true">Turn off the entropy weighting strategy (--enone)</option>
0 652f9d550531 Uploaded bgruening parents: diff changeset	149 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	150 <when value="--enone"/>
652f9d550531 Uploaded bgruening parents: diff changeset	151 <when value="--eent">
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	152 <param name="ere" type="float" value=""
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	153 label="Set the target mean match state relative entropy" help="(--ere)" optional="true"/>
0 652f9d550531 Uploaded bgruening parents: diff changeset	154
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	155 <param name="eminseq" type="integer" value=""
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	156 label="Define the minimum allowed effective sequence number" help="(--eminseq)" optional="true"/>
0 652f9d550531 Uploaded bgruening parents: diff changeset	157
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	158 <param name="emaxseq" type="integer" value=""
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	159 label="Define the maximum allowed effective sequence number" help="(--emaxseq)" optional="true"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	160
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	161 <param name="ehmmre" type="float" value=""
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	162 label="Set the target HMM mean match state relative entropy" help="(--ehmmre)" optional="true"/>
0 652f9d550531 Uploaded bgruening parents: diff changeset	163
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	164 <param name="eset" type="integer" value=""
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	165 label="Set the effective sequence number for entropy weighting" help="(--eset)" optional="true"/>
0 652f9d550531 Uploaded bgruening parents: diff changeset	166 </when>
652f9d550531 Uploaded bgruening parents: diff changeset	167 </conditional>
652f9d550531 Uploaded bgruening parents: diff changeset	168
652f9d550531 Uploaded bgruening parents: diff changeset	169 <conditional name="refining_opts">
652f9d550531 Uploaded bgruening parents: diff changeset	170 <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help="">
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	171 <option value="--refine">refine the input alignment</option>
0 652f9d550531 Uploaded bgruening parents: diff changeset	172 <option value="" selected="true">No refinement</option>
652f9d550531 Uploaded bgruening parents: diff changeset	173 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	174 <when value=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	175 <when value="--refine">
652f9d550531 Uploaded bgruening parents: diff changeset	176
652f9d550531 Uploaded bgruening parents: diff changeset	177 <conditional name="gibbs_opts">
652f9d550531 Uploaded bgruening parents: diff changeset	178 <param name="gibbs_opts_selector" type="select" label="refinement mode" help="">
652f9d550531 Uploaded bgruening parents: diff changeset	179 <option value="" selected="true">expectation-maximization (EM)</option>
652f9d550531 Uploaded bgruening parents: diff changeset	180 <option value="--gibbs">Gibbs sampling</option>
652f9d550531 Uploaded bgruening parents: diff changeset	181 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	182 <when value=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	183 <when value="--gibbs">
652f9d550531 Uploaded bgruening parents: diff changeset	184 <param name="random_seed" type="integer" value="0" label="Randam Seed" help="" />
652f9d550531 Uploaded bgruening parents: diff changeset	185 </when>
652f9d550531 Uploaded bgruening parents: diff changeset	186 </conditional>
652f9d550531 Uploaded bgruening parents: diff changeset	187
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	188 <param name="l" truevalue="-l" falsevalue="" checked="False" type="boolean"
0 652f9d550531 Uploaded bgruening parents: diff changeset	189 label="Turn on the local alignment algorithm" help="... which allows the alignment to span two or more subsequences if necessary"/>
652f9d550531 Uploaded bgruening parents: diff changeset	190
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	191 <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
0 652f9d550531 Uploaded bgruening parents: diff changeset	192 label="Turn off the truncated alignment algorithm" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	193
652f9d550531 Uploaded bgruening parents: diff changeset	194 <param name="cyk" type="select" label="Options for refining the input alignment" help="">
652f9d550531 Uploaded bgruening parents: diff changeset	195 <option value="" selected="true">optimal accuracy algorithm</option>
652f9d550531 Uploaded bgruening parents: diff changeset	196 <option value="--cyk">align with the CYK algorithm</option>
652f9d550531 Uploaded bgruening parents: diff changeset	197 </param>
652f9d550531 Uploaded bgruening parents: diff changeset	198
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	199 <param name="refine_output" truevalue="--refine" falsevalue="" checked="False" type="boolean"
0 652f9d550531 Uploaded bgruening parents: diff changeset	200 label="Output the refined alignment file as it is used to build the covariance model" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	201
652f9d550531 Uploaded bgruening parents: diff changeset	202 </when>
652f9d550531 Uploaded bgruening parents: diff changeset	203 </conditional>
652f9d550531 Uploaded bgruening parents: diff changeset	204
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	205 <param name="is_summery_output" truevalue="-o" falsevalue="" checked="False" type="boolean"
0 652f9d550531 Uploaded bgruening parents: diff changeset	206 label="Output a summery file?" help=""/>
652f9d550531 Uploaded bgruening parents: diff changeset	207
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	208 <!-- calibrate options -->
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	209 <conditional name="Calibrate">
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	210 <param name="selector" type="select" label="Calibrate the covariance model"
1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	211 help="A CM file must be calibrated with cmcalibrate before it can be used in cmsearch or cmscan. cmcalibrate is very slow. It takes a couple of hours to calibrate a single average sized CM on a single CPU">
1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	212 <option value="true">Yes</option>
1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	213 <option value="false">No</option>
1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	214 </param>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	215 <when value="false"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	216 <when value="true">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	217 <param argument="-L" type="float" value="1.6" min="0.01" max="160" label="Total length of random sequences to search" help="Set random seq length to search in Mb (megabases)"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	218 <conditional name="cont_exp_tails_fits" >
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	219 <param name="selector" type="select" label="Options controlling exponential tail fits">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	220 <option value="top_n">Fit the top 'n' hits/Mb in thehistogram</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	221 <option value="frac">Fit a fraction of the histogram</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	222 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	223 <when value="top_n">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	224 <param argument="--gtailn" type="integer" value="250" min="0" label=" Fit the top 'n' hits/Mb in histogram for glocal modes" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	225 <param argument="--ltailn" type="integer" value="750" min="0" label=" Fit the top 'n' hits/Mb in histogram for local modes" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	226 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	227 <when value="frac">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	228 <param argument="--tailp" type="float" min="0" max="0.6" optional="true" label="Set fraction of histogram tail to fit to exp tail" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	229 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	230 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	231 <conditional name="output_options_cond">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	232 <param name="selector" type="select" label="Output extra files">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	233 <option value="extra">Output extra files</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	234 <option value="none" selected="true">Don't output extra files</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	235 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	236 <when value="extra">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	237 <param name="output_options" type="select" label="Optional output files" multiple="true" display="checkboxes">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	238 <option value="hfile">save fitted score histogram(s)</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	239 <option value="sfile">save survival plot </option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	240 <option value="qqfile">save Q-Q plot for score histograms </option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	241 <option value="ffile">save lambdas for different tail fit probs</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	242 <option value="xfile">save scores in fit tail</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	243 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	244 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	245 <when value="none"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	246 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	247 <section name="add_opts" title="Additional Options">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	248 <param argument="--seed" type="integer" value="181"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	249 label="RNG seed" help="If the seed is nonzero, stochas-tic simulations will be reproducible. If 0, the random number generator is seeded arbitrarily"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	250 <param argument="--beta" type="float" value="1e-15"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	251 label="Tail loss prob. for query dependent banding (QDB)" help="The beta parameter is the amount of probability mass excluded during band calculation, higher values of beta give greater speedups but sacrifice more accuracy than lower values."/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	252 <param argument="--nonbanded" truevalue="--nonbanded" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	253 label="Turn off QDB during E-value calibration" help="This will slow down calibration"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	254 <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	255 label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	256 <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	257 label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/>
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	258 <param argument="--gc" type="data" format="txt" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	259 </section>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	260 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	261 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	262
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	263
0 652f9d550531 Uploaded bgruening parents: diff changeset	264 </inputs>
652f9d550531 Uploaded bgruening parents: diff changeset	265 <outputs>
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	266 <data format="txt" name="summary_outfile" label="cmbuild summary on ${on_string}">
0 652f9d550531 Uploaded bgruening parents: diff changeset	267 <filter>is_summery_output is True</filter>
652f9d550531 Uploaded bgruening parents: diff changeset	268 </data>
652f9d550531 Uploaded bgruening parents: diff changeset	269 <!--<data format="stockholm" name="annotated_source_alignment_outfile" label="Annotated alignment from ${on_string}"/>-->
652f9d550531 Uploaded bgruening parents: diff changeset	270 <data format="cm" name="cmfile_outfile" label="Covariance models from ${on_string}"/>
652f9d550531 Uploaded bgruening parents: diff changeset	271
652f9d550531 Uploaded bgruening parents: diff changeset	272 <data format="stockholm" name="refined_multiple_alignment_output" label="refined alignment file of ${on_string}">
652f9d550531 Uploaded bgruening parents: diff changeset	273 <filter>
652f9d550531 Uploaded bgruening parents: diff changeset	274 ((
652f9d550531 Uploaded bgruening parents: diff changeset	275 refining_opts['refining_opts_selector'] == "--refine" and
652f9d550531 Uploaded bgruening parents: diff changeset	276 refining_opts['refine_output'] is True
652f9d550531 Uploaded bgruening parents: diff changeset	277 ))
652f9d550531 Uploaded bgruening parents: diff changeset	278 </filter>
652f9d550531 Uploaded bgruening parents: diff changeset	279 </data>
652f9d550531 Uploaded bgruening parents: diff changeset	280
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	281 <!-- cmcalibrate additional output files -->
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	282 <data name="hfile" format="txt" label="hfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	283 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	284 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	285 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	286 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	287 'hfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	288 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	289 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	290 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	291 <data name="sfile" format="txt" label="sfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	292 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	293 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	294 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	295 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	296 'sfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	297 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	298 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	299 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	300 <data name="qqfile" format="txt" label="qqfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	301 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	302 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	303 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	304 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	305 'qqfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	306 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	307 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	308 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	309 <data name="ffile" format="txt" label="ffile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	310 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	311 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	312 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	313 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	314 'ffile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	315 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	316 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	317 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	318 <data name="xfile" format="txt" label="xfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	319 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	320 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	321 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	322 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	323 'xfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	324 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	325 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	326 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	327
0 652f9d550531 Uploaded bgruening parents: diff changeset	328 </outputs>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	329
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	330 <tests>
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	331 <test expect_num_outputs="1">
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	332 <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	333 <conditional name="Calibrate">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	334 <param name="selector" value="true"/>
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	335 <param name="L" value="0.1"/>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	336 </conditional>
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	337 <output name="cmfile_outfile">
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	338 <assert_contents>
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	339 <has_text text="S 0 -1 0 1 4 0 1 89 109 -7.220 -8.465 -0.063 -4.919"/>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	340 </assert_contents>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	341 </output>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	342 </test>
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	343 <!-- Test emax seq parameter -->
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	344 <test expect_num_outputs="1">
8 c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	345 <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	346 <conditional name="Calibrate">
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	347 <param name="selector" value="true"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	348 <param name="L" value="0.1"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	349 </conditional>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	350 <conditional name="effective_opts">
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	351 <param name="effective_opts_selector" value="--eent"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	352 <param name="emaxseq" value="100"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	353 </conditional>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	354 <output name="cmfile_outfile">
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	355 <assert_contents>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	356 <has_text text="S 0 -1 0 1 4 0 1 89 109 -7.111 -8.357 -0.068 -4.810"/>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	357 </assert_contents>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	358 </output>
c9e29ac5d099 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit a812ed8de433ac4e8b42afd636e70cfbb180d2b9" bgruening parents: 6 diff changeset	359 </test>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	360 </tests>
0 652f9d550531 Uploaded bgruening parents: diff changeset	361 <help>
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	362 <![CDATA[
0 652f9d550531 Uploaded bgruening parents: diff changeset	363
652f9d550531 Uploaded bgruening parents: diff changeset	364 What it does
652f9d550531 Uploaded bgruening parents: diff changeset	365
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	366 cmbuild belongs to the INFERNAL software package that allows you to make consensus RNA secondary structure profiles, and use them to search nucleic acid sequence databases for homologous RNAs, or to create new structure-based multiple sequence alignments.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	367
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	368 cm build builds a covariance model of an RNA multiple alignment. cmbuild uses the consensus structure to determine the architecture of the CM.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	369
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	370 Input
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	371
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	372 Input file is a multiple sequence alignment file in Stockholm format, and must contain consensus secondary structure annotation.
0 652f9d550531 Uploaded bgruening parents: diff changeset	373 cmbuild uses the consensus structure to determine the architecture of the CM.
652f9d550531 Uploaded bgruening parents: diff changeset	374
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	375 Example: simple example of a multiple RNA sequence alignment with secondary structure annotation
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	376
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	377 # STOCKHOLM 1.0
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	378
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	379 tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	380
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	381 tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	382
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	383 tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	384
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	385 tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	386
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	387 tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	388
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	389 #=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
0 652f9d550531 Uploaded bgruening parents: diff changeset	390
652f9d550531 Uploaded bgruening parents: diff changeset	391
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	392 Output
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	393
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	394 The output of cmbuild contains information about the size of your input alignment (in aligned columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	395 and # of sequences), and about the size of the resulting model.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	396
4 c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	397 In addition to writing CM(s) to the output file, cmbuild also outputs a single line for each model created to stdout.
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	398 Each line has the following fields:
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8 bgruening parents: 3 diff changeset	399 - aln: the index of the alignment used to build the CM
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	400 - idx: the index of the CM in the output file
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	401 - name: the name of the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	402 - nseq: the number of sequences in the alignment used to build the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	403 - eff nseq: the effective number of sequences used to build the model
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	404 - alen: the length of the alignment used to build the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	405 - clen: the number of columns from the alignment defined as consensus (match) columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	406 - bps: the number of basepairs in the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	407 - bifs: the number of bifurcations in the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	408 - rel entropy: CM: the total relative entropy of the model divided by the number of consensus columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	409 - rel entropy: HMM: the total relative entropy of the model ignoring secondary structure divided by the number of consensus columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	410 - description: description of the model/alignment.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	411
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	412
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	413 Options controlling model construction
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	414
0 652f9d550531 Uploaded bgruening parents: diff changeset	415 These options control how consensus columns are defined in an alignment.
652f9d550531 Uploaded bgruening parents: diff changeset	416
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	417 - --fast: Define consensus columns automatically as those that have a fraction >= symfrac of residues as opposed to gaps. (See below for the --symfrac option.) This is the default.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	418 - --hand: Use reference coordinate annotation (#=GC RF line, in Stockholm) to determine which columns are consensus, and which are inserts. Any non-gap character indicates a consensus column. (For example, mark consensus columns with ”x”, and insert columns with ”.”.)
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	419 - --symfrac: Define the residue fraction threshold necessary to define a consensus column when not using --hand. The default is 0.5. The symbol fraction in each column is calculated after taking relative sequence weighting into account. Setting this to 0.0 means that every alignment column will be assigned as consensus, which may be useful in some cases. Setting it to 1.0 means that only columns that include 0 gaps will be assigned as consensus.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	420 - --noss: Ignore the secondary structure annotation, if any, in MSA-Infile and build a CM with zero basepairs. This model will be similar to a profile HMM and the cmsearch and cmscan programs will use HMM algorithms which are faster than CM ones for this model. Additionally, a zero basepair model need not be calibrated with cmcalibrate prior to running cmsearch with it. The --noss option must be used if there is no secondary structure annotation in MSA-Infile.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	421
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	422
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	423 Options controlling relative weights
0 652f9d550531 Uploaded bgruening parents: diff changeset	424
652f9d550531 Uploaded bgruening parents: diff changeset	425
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	426 cmbuild uses an ad hoc sequence weighting algorithm to downweight closely related sequences and upweight distantly related ones. This has the effect of making models less biased by uneven phylogenetic representation. For example, two identical sequences would typically each receive half the weight that one sequence would. These options control which algorithm gets used.
0 652f9d550531 Uploaded bgruening parents: diff changeset	427
9 1d74ed49cf41 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 09c1d4ab75f5cd057ed57bf694217f0e355f785e bgruening parents: 8 diff changeset	428 - --wgb: Use the Henikoff position-based sequence weighting scheme [Henikoff and Henikoff, J. Mol. Biol. 243:574, 1994]. This is the default.
6 ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba bgruening parents: 5 diff changeset	429 - --wgsc: Use the Gerstein/Sonnhammer/Chothia weighting algorithm [Gerstein et al, J. Mol. Biol. 235:1067, 1994].
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	430 - --wnone: Turn sequence weighting off; e.g. explicitly set all sequence weights to 1.0.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	431 - --wgiven: Use sequence weights as given in annotation in the input alignment file. If no weights were given, assume they are all 1.0. The default is to determine new sequence weights by the Gerstein/Sonnhammer/Chothia algorithm, ignoring any annotated weights.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	432 - --wblosum: Use the BLOSUM filtering algorithm to weight the sequences, instead of the default GSC weighting. Cluster the sequences at a given percentage identity (see --wid); assign each cluster a total weight of 1.0, distributed equally amongst the members of that cluster.
0 652f9d550531 Uploaded bgruening parents: diff changeset	433
652f9d550531 Uploaded bgruening parents: diff changeset	434
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	435 Options controlling effective sequence number
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	436
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	437
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	438 After relative weights are determined, they are normalized to sum to a total effective sequence number, eff nseq. This number may be the actual number of sequences in the alignment, but it is almost always smaller than that. The default entropy weighting method (--eent) reduces the effective sequence number to reduce the information content (relative entropy, or average expected score on true homologs) per consensus position. The target relative entropy is controlled by a two-parameter function, where the two parameters are settable with --ere and --esigma.
0 652f9d550531 Uploaded bgruening parents: diff changeset	439
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	440 - --eent: Use the entropy weighting strategy to determine the effective sequence number that gives a target mean match state relative entropy. This option is the default, and can be turned off with --enone. The default target mean match state relative entropy is 0.59 bits for models with at least 1 basepair and 0.38 bits for models with zero basepairs, but changed with --ere. The default of 0.59 or 0.38 bits is automatically changed if the total relative entropy of the model (summed match state relative entropy) is less than a cutoff, which is is 6.0 bits by default, but can be changed with the expert, undocumented --eX option. If you really want to play with that option, consult the source code.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	441 - --enone: Turn off the entropy weighting strategy. The effective sequence number is just the number of sequences in the alignment.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	442 - --ere: Set the target mean match state relative entropy. By default the target relative entropy per match position is 0.59 bits for models with at least 1 basepair and 0.38 for models with zero basepairs.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	443 - --eminseq: Define the minimum allowed effective sequence number.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	444 - --ehmmre: Set the target HMM mean match state relative entropy. Entropy for basepairing match states is calculated using marginalized basepair emission probabilities.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	445 - --eset: Set the effective sequence number for entropy weighting.
0 652f9d550531 Uploaded bgruening parents: diff changeset	446
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	447 Options for refining the input alignment
0 652f9d550531 Uploaded bgruening parents: diff changeset	448
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	449 - --refine: Attempt to refine the alignment before building the CM using expectation-maximization (EM). A CM is first built from the initial alignment as usual. Then, the sequences in the alignment are realigned optimally (with the HMM banded CYK algorithm, optimal means optimal given the bands) to the CM, and a new CM is built from the resulting alignment. The sequences are then realigned to the new CM, and a new CM is built from that alignment. This is continued until convergence, specifically when the alignments for two successive iterations are not significantly different (the summed bit scores of all the sequences in the alignment changes less than 1% between two successive iterations).
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	450 - Turn on the local alignment algorithm: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	451 - --gibbs sampling: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	452 - --Random seed: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	453 - --Turn off the truncated alignment algorithm: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
3 2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty bgruening parents: 2 diff changeset	454 - --cyk algorithm: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.
0 652f9d550531 Uploaded bgruening parents: diff changeset	455
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	456
0 652f9d550531 Uploaded bgruening parents: diff changeset	457 For further questions please refere to the Infernal Userguide_.
652f9d550531 Uploaded bgruening parents: diff changeset	458
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	459 .. _Userguide: http://eddylab.org/infernal/Userguide.pdf
0 652f9d550531 Uploaded bgruening parents: diff changeset	460
2 fac157e22e1b Uploaded bgruening parents: 0 diff changeset	461 ]]>
0 652f9d550531 Uploaded bgruening parents: diff changeset	462 </help>
5 6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	463
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	464 <expand macro="citations" />
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 bgruening parents: 4 diff changeset	465
0 652f9d550531 Uploaded bgruening parents: diff changeset	466 </tool>

Mercurial > repos > bgruening > infernal

annotate cmbuild.xml @ 9:1d74ed49cf41 draft default tip