--- a/cmbuild.xml	Sat Jan 21 17:36:57 2017 -0500
+++ b/cmbuild.xml	Fri Nov 10 13:04:44 2017 -0500
@@ -65,7 +65,7 @@
 
     #if $Calibrate.selector=="true"
         && cmcalibrate
-            -L$Calibrate.L
+            -L $Calibrate.L
             #if $Calibrate.output_options_cond.selector == "extra"
                 #if str($Calibrate.output_options_cond.output_options) != 'None'
                     #for j in $Calibrate.output_options_cond.output_options.value:
@@ -94,10 +94,7 @@
 ]]>
     </command>
         <inputs>
-            <!-- Stockholm or SELEX
-            SELEX is defined in EMBOSS datatypes
-            -->
-            <param name="alignment_infile" type="data" format="stockholm,selex" label="Sequence database"/>
+            <param name="alignment_infile" type="data" format="stockholm" label="Sequence database"/>
 
             <conditional name="model_construction_opts">
                 <param name="model_construction_opts_selector" type="select" label="These options control how consensus columns are defined in an alignment" help="">
@@ -248,7 +245,7 @@
                             label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/>
                         <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean"
                             label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/>
-                        <param argument="--gc" type="data" format="*" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
+                        <param argument="--gc" type="data" format="txt" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
                     </section>
                 </when>
             </conditional>
@@ -325,10 +322,11 @@
             <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
             <conditional name="Calibrate">
                 <param name="selector" value="true"/>
+                <param name="L" value="0.1"/>
             </conditional>
             <output name="outfile">
                 <assert_contents>
-                    <has_text text="S     0    -1 0     1     4     0     1    88   108  -7.713  -8.959  -0.044  -5.412"/>
+                    <has_text text="S     0    -1 0     1     4     0     1    89   109  -7.220  -8.465  -0.063  -4.919"/>
                 </assert_contents>
             </output>
         </test>
@@ -344,7 +342,7 @@
 
 **Input**
 
-Input file is a multiple sequence alignment file in Stockholm or SELEX format, and must contain consensus secondary structure annotation.
+Input file is a multiple sequence alignment file in Stockholm format, and must contain consensus secondary structure annotation.
 cmbuild uses the consensus structure to determine the architecture of the CM.
 
 Example: simple example of a multiple RNA sequence alignment with secondary structure annotation
@@ -400,8 +398,9 @@
 
 cmbuild uses an ad hoc sequence weighting algorithm to downweight closely related sequences and upweight distantly related ones. This has the effect of making models less biased by uneven phylogenetic representation. For example, two identical sequences would typically each receive half the weight that one sequence would. These options control which algorithm gets used.
 
-  - *--wgb*: Use the Henikoff position-based sequence weighting scheme ([Henikoff and Henikoff](http://zhanglab.ccmb.med.umich.edu/literature/henikoff_weight_1994.pdf), J. Mol. Biol. 243:574, 1994). This is the default.
-  - *--wgsc*: Use the Gerstein/Sonnhammer/Chothia weighting algorithm ([Gerstein et al.](http://ac.els-cdn.com/0022283694900124/1-s2.0-0022283694900124-main.pdf?_tid=6ed29974-3044-11e5-8949-00000aacb35f&acdnat=1437550798_aaa62caa2c812bb81013f967e7b119ee), J. Mol. Biol. 236:1067, 1994).
+  - *--wgb*: Use the Henikoff position-based sequence weighting scheme [Henikoff
+and Henikoff, J. Mol. Biol. 243:574, 1994].  This is the default.
+  - *--wgsc*: Use the Gerstein/Sonnhammer/Chothia weighting algorithm [Gerstein et al, J. Mol. Biol. 235:1067, 1994].
   - *--wnone*: Turn sequence weighting off; e.g. explicitly set all sequence weights to 1.0.
   - *--wgiven*: Use sequence weights as given in annotation in the input alignment file. If no weights were given, assume they are all 1.0. The default is to determine new sequence weights by the Gerstein/Sonnhammer/Chothia algorithm, ignoring any annotated weights.
   - *--wblosum*: Use the BLOSUM filtering algorithm to weight the sequences, instead of the default GSC weighting. Cluster the sequences at a given percentage identity (see --wid); assign each cluster a total weight of 1.0, distributed equally amongst the members of that cluster.

Binary file infernal.tar.gz has changed

--- a/macros.xml	Sat Jan 21 17:36:57 2017 -0500
+++ b/macros.xml	Fri Nov 10 13:04:44 2017 -0500
@@ -3,7 +3,7 @@
         <requirements>
             <requirement type="package">infernal</requirement>
             <requirement type="package" version="1.1.2">infernal</requirement>
-            <requirement type="package" version="8.22">gnu_coreutils</requirement>
+            <requirement type="package" version="8.25">coreutils</requirement>
         </requirements>
     </xml>
     <token name="@VERSION@">1.1.2</token>

--- a/test-data/cmbuild_input_tRNA5.sto	Sat Jan 21 17:36:57 2017 -0500
+++ b/test-data/cmbuild_input_tRNA5.sto	Fri Nov 10 13:04:44 2017 -0500
@@ -3,14 +3,10 @@
 tRNA1             GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
 tRNA2             UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
 tRNA3             UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
-tRNA4             GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
-tRNA5             GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
 #=GC SS_cons      <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
 
 tRNA1             UGUGUUCGAUCCACAGAAUUCGCA
 tRNA2             GGGGUUCGACUCCCCGUAUCGGAG
 tRNA3             GGGGUUCAAUUCCCCGUCGCGGAG
-tRNA4             UUAGUUCGAUCCUGAGUGCGAGCU
-tRNA5             UCGGUUCGAUUCCGGUUGCGUCCA
 #=GC SS_cons      <<<<.......>>>>>>>>>>>>.
 //