Mercurial > repos > bgruening > locarna_multiple
comparison locarna_multiple.xml @ 0:008f5c13670e draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 1d1d9aac8cb96d043be07f2e4059baa3b05c2afc
author | bgruening |
---|---|
date | Wed, 28 Dec 2016 18:47:18 -0500 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:008f5c13670e |
---|---|
1 <tool id="locarna_multiple" name="LocARNA Multiple Aligner (mlocarna)" version="@VERSION@.0"> | |
2 <description> | |
3 Multiple Alignment and Folding of RNAs | |
4 </description> | |
5 | |
6 <macros> | |
7 <import>macros.xml</import> | |
8 </macros> | |
9 | |
10 <expand macro="requirements" /> | |
11 | |
12 <expand macro="stdio" /> | |
13 | |
14 <expand macro="version" /> | |
15 | |
16 <command><![CDATA[ | |
17 mlocarna | |
18 | |
19 '$input_data' | |
20 #if 'stockholm' in str($outputs).split(","): | |
21 --stockholm | |
22 #end if | |
23 | |
24 --tgtdir mlocarna_results | |
25 --width 60 | |
26 | |
27 ## -------------------- alignment mode and specific options | |
28 | |
29 #if str($alignment_mode.alignment_mode_selector) == "global_locarna" | |
30 $alignment_mode.free_endgaps | |
31 #else if str($alignment_mode.alignment_mode_selector) == "local_locarna" | |
32 --sequ-local on | |
33 #else if str($alignment_mode.alignment_mode_selector) == "probabilistic" | |
34 --probabilistic | |
35 $alignment_mode.consistency_transformation | |
36 | |
37 #if str($alignment_mode.iterate) == "true" | |
38 --iterate | |
39 --iterations $alignment_mode.iterations | |
40 #end if | |
41 #else if str($alignment_mode.alignment_mode_selector) == "sparse" | |
42 --sparse | |
43 #end if | |
44 | |
45 ## -------------------- scoring parameters | |
46 | |
47 --indel $Scoring.indel | |
48 --indel-opening $Scoring.indel_opening | |
49 --struct-weight $Scoring.struct_weight | |
50 --tau $Scoring.tau | |
51 | |
52 #if str($Scoring.sequence_score.sequence_score_selector) == "match" | |
53 --match $Scoring.sequence_score.match | |
54 --mismatch $Scoring.sequence_score.mismatch | |
55 #else if str($Scoring.sequence_score.sequence_score_selector) == "ribosum" | |
56 --use-ribosum true | |
57 #else if str($Scoring.sequence_score.sequence_score_selector) == "ribofit" | |
58 --ribofit true | |
59 #end if | |
60 | |
61 ## -------------------- folding parameters | |
62 | |
63 #if $Folding.plfold_span>=0 | |
64 --plfold-span $Folding.plfold_span | |
65 --plfold-winsize $Folding.plfold_winsize | |
66 #end if | |
67 | |
68 #if float($Folding.rnafold_temperature) != 37.0 | |
69 --rnafold-temperature $Folding.rnafold_temperature | |
70 #end if | |
71 | |
72 $Folding.alifold_consensus_dp | |
73 | |
74 ## -------------------- heuristic parameters | |
75 | |
76 -p $Heuristics.min_prob | |
77 --max-diff-am $Heuristics.max_diff_am | |
78 --max-diff $Heuristics.max_diff | |
79 --max-diff-at-am $Heuristics.max_diff_at_am | |
80 --max-bps-length-ratio $Heuristics.max_bps_length_ratio | |
81 | |
82 | |
83 ## -------------------- other parameters | |
84 | |
85 #if str($Constraint.bed_anchors.bed_anchors_selector) == "yes" | |
86 --anchor-constraints $Constraint.bed_anchors.bed_anchors_file | |
87 #end if | |
88 | |
89 $Constraint.lonely_pairs | |
90 | |
91 #if $Constraint.maxBPspan != -1 | |
92 --maxBPspan $Constraint.maxBPspan | |
93 #end if | |
94 | |
95 $Constraint.ignore_constraints | |
96 | |
97 $stdout_verbosity | |
98 | |
99 #if str($stdout_verbosity) != "--quiet": | |
100 > '$stdout' | |
101 #end if | |
102 | |
103 #if 'clustal_strict' in str($outputs).split(",") | |
104 && grep -v '^#' mlocarna_results/results/result.aln > mlocarna_results/results/result.strict-aln | |
105 #end if | |
106 | |
107 ]]></command> | |
108 | |
109 <inputs> | |
110 <conditional name="input_data_type"> | |
111 <param name="input_data_type_selector" type="select" label="Input type"> | |
112 <option value="fasta">Fasta input (strict)</option> | |
113 <option value="text">Fasta-like input with LocARNA constraints</option> | |
114 </param> | |
115 <when value="fasta"> | |
116 <param name="input_data" type="data" format="fasta" label="Sequence input" | |
117 help="Sequence input in pure fasta format" | |
118 /> | |
119 </when> | |
120 <when value="text"> | |
121 <param name="input_data" type="data" format="text" label="Sequence input" | |
122 help="Sequence input in fasta format with locarna-specific extensions" | |
123 /> | |
124 </when> | |
125 </conditional> | |
126 <conditional name="alignment_mode"> | |
127 <param name="alignment_mode_selector" type="select" label="Alignment mode" | |
128 help="Note that local alignment mode usually requires to turn off | |
129 the 'max-diff' heuristic (maximal difference for alignment traces)." | |
130 > | |
131 <option value="global_locarna">Global alignment | |
132 (LocARNA)</option> | |
133 <option value="local_locarna">Local alignment (LocARNA)</option> | |
134 <option value="probabilistic">Probabilistic alignment (LocARNA-P)</option> | |
135 <option value="sparse">Global alignment (SPARSE)</option> | |
136 </param> | |
137 <when value="global_locarna"> | |
138 <param name="free_endgaps" type="select" label="Free endgaps" | |
139 help="Specify whether gaps at the ends (all, 5', or 3' ends) | |
140 of the sequences should be penalized or allowed for free."> | |
141 <option value="">No free endgaps</option> | |
142 <option value="--free-endgaps">Free endgaps</option> | |
143 <option value="--free-endgaps-5">Free endgaps, only 5'</option> | |
144 <option value="--free-endgaps-3">Free endgaps, only 3'</option> | |
145 </param> | |
146 </when> | |
147 <when value="local_locarna"> | |
148 </when> | |
149 <when value="probabilistic"> | |
150 <param name="consistency_transformation" type="boolean" | |
151 truevalue="--consistency-transformation" falsevalue="" | |
152 checked="true" label="Consistency transformation" | |
153 help="--consistency-transformation" /> | |
154 <param name="iterate" type="boolean" | |
155 truevalue="true" falsevalue="false" | |
156 checked="false" label="Iterative refinement" | |
157 help="--iterate" /> | |
158 <param name="iterations" type="integer" | |
159 value="1" label="Number of refinement iterations" | |
160 help="--iterations num" /> | |
161 </when> | |
162 <when value="sparse" /> | |
163 </conditional> | |
164 | |
165 <param name="outputs" type="select" display="checkboxes" multiple="True" | |
166 label="Output options"> | |
167 <option value="clustal_strict" selected="True">Output alignment | |
168 in ClustalW format</option> | |
169 <option value="clustal" selected="False">Output alignment | |
170 in constraint-annotated ClustalW format</option> | |
171 <option value="stockholm" selected="False">Output | |
172 alignment in Stockholm format</option> | |
173 <option value="pp" selected="False">Output | |
174 alignment in LocARNA's PP 2.0 format</option> | |
175 <option value="mlocarna_results" selected="False"> | |
176 Output LocARNA results archive (tar.gz)</option> | |
177 </param> | |
178 | |
179 <param name="stdout_verbosity" type="select" label="Standard output verbosity"> | |
180 <option value="--quiet">Don't report standard | |
181 output</option> | |
182 <option value="">Non verbose</option> | |
183 <option value="--verbose">Verbose</option> | |
184 <option value="--moreverbose">More verbose</option> | |
185 </param> | |
186 | |
187 <section name="Scoring" title="Scoring parameters"> | |
188 <expand macro="common_scoring_parameters" /> | |
189 </section> | |
190 | |
191 <section name="Folding" title="RNA folding parameters"> | |
192 <expand macro="plfolding_parameters" /> | |
193 <expand macro="common_folding_parameters" /> | |
194 <expand macro="alifold_consensus_parameter" /> | |
195 </section> | |
196 | |
197 <section name="Heuristics" title="Heuristic parameters"> | |
198 <expand macro="common_heuristic_parameters" /> | |
199 </section> | |
200 | |
201 <section name="Constraint" title="Constraint parameters"> | |
202 <expand macro="bed_anchors" /> | |
203 <expand macro="constraints" /> | |
204 </section> | |
205 </inputs> | |
206 | |
207 <outputs> | |
208 <expand macro="common_outputs" /> | |
209 </outputs> | |
210 | |
211 <tests> | |
212 <test> | |
213 <param name="input_data" value="archaea.fa" /> | |
214 <param name="stdout_verbosity" value="" /> | |
215 <output name="stdout" file="archaea-default.stdout" /> | |
216 </test> | |
217 <test> | |
218 <param name="input_data" value="haca.snoRNA.fa" /> | |
219 <param name="stdout_verbosity" value="" /> | |
220 <output name="stdout" file="haca.snoRNA-default.stdout" /> | |
221 </test> | |
222 <test> | |
223 <param name="input_data" value="archaea.fa" /> | |
224 <param name="stdout_verbosity" value="" /> | |
225 <param name="outputs" value="clustal" /> | |
226 <param name="alignment_mode_selector" value="probabilistic" /> | |
227 <output name="clustal" file="archaea-probabilistic.aln" /> | |
228 </test> | |
229 </tests> | |
230 | |
231 <help><![CDATA[ **MLocARNA -- Multiple alignment of RNAs** | |
232 | |
233 MLocARNA is the (general, progressive) multiple RNA alignment tool of | |
234 the LocARNA suite. It supports several alignment modes and can be | |
235 adapted to specific needs by a broad range of parameters. Thus, there | |
236 are parameters for | |
237 | |
238 * *scoring* of the alignment, e.g. influencing the cost of | |
239 insertions/deletions and the weight of sequence vs. structure | |
240 similarity. | |
241 | |
242 * *RNA folding*, which control the secondary RNA structure prediciton. | |
243 | |
244 * *heuristics*, which trade alignment accuracy vs. computation | |
245 speed. The huge complexity of simultaneous alignment and folding | |
246 generally requires some heuristics for reasonable computation times. | |
247 Some alignment instances and alignment modes will require relaxation | |
248 of the default heuristics; in particular, local, constrained, and free end gap | |
249 alignment, will often require turning off the "maximal difference for | |
250 alignment traces" heuristic. | |
251 | |
252 * *constraints*, which can be applied to include prior knowledge to | |
253 improve the quality of results and/or speed of computation. | |
254 | |
255 Technically, mlocarna constructs multiple alignments progressively | |
256 based on pairwise alignments by locarna, locarna-p, or sparse, which | |
257 perform variants of simultaneous RNA folding and alignment. | |
258 | |
259 **Input.** | |
260 Sequences can be given in plain fasta format like:: | |
261 | |
262 >fruA | |
263 CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG | |
264 >fdhA | |
265 CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG | |
266 >vhuU | |
267 AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU | |
268 | |
269 Morover, mlocarna supports structure constraints for folding and anchor | |
270 constraints for alignment. Both types of constraints can be specified | |
271 in extension of the standard fasta format via 'constraint | |
272 lines'. Fasta-ish input with constraints looks like this:: | |
273 | |
274 >A | |
275 GACCCUGGGAACAUUAACUACUCUCGUUGGUGAUAAGGAACA | |
276 ..((.(....xxxxxx...................))).xxx #S | |
277 ..........000000.......................111 #1 | |
278 ..........123456.......................123 #2 | |
279 >B | |
280 ACGGAGGGAAAGCAAGCCUUCUGCGACA | |
281 .(((....xxxxxx.......))).xxx #S | |
282 ........000000...........111 #1 | |
283 ........123456...........123 #2 | |
284 | |
285 The same anchor constraints (like by the lines tagged #1, #2) can | |
286 alternatively be specified in bed format by the entries:: | |
287 | |
288 A 10 16 first_box | |
289 B 8 14 first_box | |
290 A 39 42 ACA-box | |
291 B 25 28 ACA-box | |
292 | |
293 where anchor regions (boxes) have arbitrary but matching names | |
294 and contig/sequence names correspond to the sequence names | |
295 of the fasta(-like) input. | |
296 | |
297 | |
298 **Output.** | |
299 | |
300 The final alignment is reported in standard and/or variants of the | |
301 clustal and stockholm format. Moreover, an archive with final and | |
302 intermediary results of the mlocarna run can be returned. | |
303 | |
304 | |
305 For more information, see | |
306 .. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/ | |
307 ]]></help> | |
308 | |
309 <expand macro="citations" /> | |
310 | |
311 </tool> |