Mercurial > repos > bgruening > locarna_pairwise
changeset 0:b4310d79bbfb draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/locarna commit 1d1d9aac8cb96d043be07f2e4059baa3b05c2afc
| author | bgruening |
|---|---|
| date | Wed, 28 Dec 2016 18:48:14 -0500 |
| parents | |
| children | |
| files | locarna.tar.bz2 locarna_pairwise.xml macros.xml test-data/archaea-default.stdout test-data/archaea-probabilistic.aln test-data/archaea.fa test-data/archaea.tar.gz test-data/archaea_relplot.scr test-data/haca.snoRNA-default.stdout test-data/haca.snoRNA.fa test-data/haca.snoRNA_anchor.bed test-data/tRNA_2-1.fa test-data/tRNA_2-2.fa test-data/tRNA_2.aln test-data/tRNA_5.fa |
| diffstat | 15 files changed, 725 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/locarna_pairwise.xml Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,284 @@ +<tool id="locarna_pairwise" name="LocARNA Pairwise Aligner" version="@VERSION@.0"> + <description> + Pairwise Simultaneous Alignment and Folding of RNAs + </description> + + <macros> + <import>macros.xml</import> + </macros> + + <expand macro="requirements" /> + + <expand macro="stdio" /> + + <expand macro="version" /> + + <command><![CDATA[ + #if str($alignment_mode.alignment_mode_selector) == "sparse" + sparse + #else + locarna + #end if + + '$inputA' + '$inputB' + + --width 60 + + ## -------------------- alignment mode and specific options + + #if str($alignment_mode.alignment_mode_selector) == "global_locarna" + #if str($alignment_mode.free_endgaps) != "----" + --free-endgaps $alignment_mode.free_endgaps + #end if + #else if str($alignment_mode.alignment_mode_selector) == "local_locarna" + --sequ-local on + #else if str($alignment_mode.alignment_mode_selector) == "structure_local_locarna" + --struct-local on + #else if str($alignment_mode.alignment_mode_selector) == "structure_sequence_local_locarna" + --sequ-local on + --struct-local on + #end if + + ## -------------------- scoring parameters + + --indel $Scoring.indel + --indel-opening $Scoring.indel_opening + --struct-weight $Scoring.struct_weight + --tau $Scoring.tau + + #if str($Scoring.sequence_score.sequence_score_selector) == "match" + --match $Scoring.sequence_score.match + --mismatch $Scoring.sequence_score.mismatch + #else if str($Scoring.sequence_score.sequence_score_selector) == "ribosum" + --use-ribosum true + #else if str($Scoring.sequence_score.sequence_score_selector) == "ribofit" + --ribofit true + #end if + + ## -------------------- folding parameters + + #if float($Folding.rnafold_temperature) != 37.0 + --rnafold-temperature $Folding.rnafold_temperature + #end if + + $Folding.alifold_consensus_dp + --consensus-structure $Folding.consensus_structure + + ## -------------------- heuristic parameters + + -p $Heuristics.min_prob + --max-diff-am $Heuristics.max_diff_am + --max-diff $Heuristics.max_diff + --max-diff-at-am $Heuristics.max_diff_at_am + + #if float($Heuristics.max_bps_length_ratio) != 0.0 + --max-bps-length-ratio $Heuristics.max_bps_length_ratio + #end if + + ## -------------------- other parameters + + $Constraint.lonely_pairs + + #if $Constraint.maxBPspan != -1 + --maxBPspan $Constraint.maxBPspan + #end if + + $Constraint.ignore_constraints + + ## -------------------- output + + #if 'stockholm' in str($outputs).split(",") + --stockholm '$stockholm' + #end if + #if 'clustal' in str($outputs).split(",") + --clustal '$clustal' + #end if + #if 'clustal_strict' in str($outputs).split(",") and (not 'clustal' in str($outputs).split(",")) + --clustal '$clustal_strict' + #end if + #if 'pp' in str($outputs).split(",") + --pp '$pp' + #end if + + $stdout_verbosity + + #if str($stdout_verbosity) != "--quiet": + > '$stdout' + #end if + + #if 'clustal' in str($outputs).split(",") and 'clustal_strict' in str($outputs).split(",") + && cp $clustal $clustal_strict + #end if + + #if 'clustal_strict' in str($outputs).split(",") + && sed -i '/\^#/d' '$clustal_strict' + #end if + + ]]></command> + + <inputs> + <param name="inputA" type="data" format="fasta,clustal,txt" label="Sequence A" + help="First sequence in fasta, clustal, dp_ps, or PP2.0 format" + /> + <param name="inputB" type="data" format="fasta,clustal,txt" label="Sequence B" + help="Second sequence in fasta, clustal, dp_ps, or PP2.0 format" + /> + <conditional name="alignment_mode"> + <param name="alignment_mode_selector" type="select" label="Alignment mode" + help="Note that local alignment mode usually requires to turn off + the 'max-diff' heuristic (maximal difference for alignment traces)." + > + <option value="global_locarna">Global alignment + (LocARNA)</option> + <option value="local_locarna">Local alignment (LocARNA)</option> + <option value="sparse">Global alignment (SPARSE)</option> + <option value="structure_sequence_local_locarna"> + Structure and sequence local alignment (LocARNA) + </option> + <option value="structure_local_locarna"> + Structure local, sequence global alignment (LocARNA) + </option> + </param> + <when value="global_locarna"> + <param name="free_endgaps" type="select" label="Free endgaps" + help="Specify whether gaps at the ends (all, 5', or 3' ends) + of the sequences should be penalized or allowed for free."> + <option value="----">None</option> + <option value="++++">All</option> + <option value="+-+-">5' ends</option> + <option value="-+-+">3' ends</option> + <option value="++--">first sequence</option> + <option value="--++">second sequence</option> + <option value="+---">sequence A, 5' end</option> + <option value="-+--">sequence A, 3' end</option> + <option value="--+-">sequence B, 5' end</option> + <option value="---+">sequence B, 3' end</option> + </param> + </when> + <when value="local_locarna"> + </when> + <when value="sparse" /> + <when value="structure_sequence_local_locarna" /> + <when value="structure_local_locarna" /> + </conditional> + + <param name="outputs" type="select" display="checkboxes" multiple="True" + label="Output options"> + <option value="clustal_strict" selected="True">Output alignment + in ClustalW format</option> + <option value="clustal" selected="False">Output alignment + in constraint-annotated ClustalW format</option> + <option value="stockholm" selected="False">Output + alignment in Stockholm format</option> + <option value="pp" selected="False">Output + alignment in LocARNA's PP 2.0 format</option> + </param> + + <param name="stdout_verbosity" type="select" label="Standard output verbosity"> + <option value="--quiet">Don't report standard + output</option> + <option value="">Non verbose</option> + <option value="--verbose">Verbose</option> + </param> + + <section name="Scoring" title="Scoring parameters"> + <expand macro="common_scoring_parameters" /> + </section> + + <section name="Folding" title="RNA folding parameters"> + <expand macro="common_folding_parameters" /> + <expand macro="alifold_consensus_parameter" /> + <param name="consensus_structure" type="select" label="Consensus structure type" + help="Type of consensus structures written to screen and stockholm output" + > + <!-- <option value="mea">mea</option>--> + <option value="none">none</option> + <option value="alifold">alifold</option> + </param> + </section> + + <section name="Heuristics" title="Heuristic parameters"> + <expand macro="common_heuristic_parameters" /> + </section> + + <section name="Constraint" title="Constraint parameters"> + <expand macro="constraints" /> + </section> + </inputs> + + <outputs> + <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}"> + <filter>stdout_verbosity != '--quiet'</filter> + </data> + <data format="clustal" name="clustal" + label="${tool.name} alignment (annotated clustal) on ${on_string}"> + <filter>'clustal' in outputs</filter> + </data> + <data format="clustal" name="clustal_strict" + label="${tool.name} alignment (clustal) on ${on_string}"> + <filter>'clustal_strict' in outputs</filter> + </data> + <data format="stockholm" name="stockholm" + label="${tool.name} alignment (stockholm) on ${on_string}"> + <filter>'stockholm' in outputs</filter> + </data> + <data format="txt" name="pp" + label="${tool.name} alignment (PP 2.0) on ${on_string}"> + <filter>'pp' in outputs</filter> + </data> + </outputs> + + <tests> + <test> + <param name="inputA" value="tRNA_2-1.fa" /> + <param name="inputB" value="tRNA_2-2.fa" /> + <param name="outputs" value="clustal" /> + <output name="clustal" file="tRNA_2.aln" /> + </test> + </tests> + + <help><![CDATA[ **LocARNA -- Pairwise alignment of RNAs** + +Pairwise RNA alignment tools of the LocARNA suite (locarna, +sparse). These tools perform variants of simultaneous RNA folding and +alignment. They can be adapted to specific needs by a broad range of +parameters: + +* *scoring* of the alignment, e.g. influencing the cost of + insertions/deletions and the weight of sequence vs. structure + similarity. + +* *RNA folding*, which control the secondary RNA structure prediciton. + +* *heuristics*, which trade alignment accuracy vs. computation + speed. The huge complexity of simultaneous alignment and folding + generally requires some heuristics for reasonable computation times. + Some alignment instances and alignment modes will require relaxation + of the default heuristics; in particular, local, constrained, and free end gap + alignment, will often require turning off the "maximal difference for + alignment traces" heuristic. + +* *constraints*, which can be applied to include prior knowledge to + improve the quality of results and/or speed of computation. + +**Input.** + +Input consists of two sequences or alignments, which are specified in +fasta, clustal, stockholm, or LocARNA pp format. + +Optionally, one can specify structure and anchor constraints in these +input files. + +**Output.** + +The final pairwise alignment is reported in standard and/or variants of the +clustal and stockholm format, as well as LocARNA's own pp format. + +For more information, see +.. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/ + ]]></help> + + <expand macro="citations" /> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,178 @@ +<macros> + <token name="@VERSION@">1.9.0</token> + + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">locarna</requirement> + </requirements> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + </stdio> + </xml> + + <xml name="version"> + <version_command> + <![CDATA[ + mlocarna --version + ]]> + </version_command> + </xml> + + <xml name="bed_anchors"> + <conditional name="bed_anchors"> + <param name="bed_anchors_selector" type="select" label="Anchor constraints" + help="Anchor constraints in bed format specify positions of + named anchor regions per sequence. The sequence names + ('contig' names have to correspond to the fasta input + sequence names. Anchor names must be unique per sequence + and regions of the same name for different sequences + must have the same length. This constrains the alignment + to align all regions of the same name."> + <option value="no">Don't load anchor constraints from bed file</option> + <option value="yes">Load anchor constraints from bed file</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="bed_anchors_file" type="data" format="tabular" + label="Anchor constraint specification in bed format" + /> + </when> + </conditional> + </xml> + + <xml name="common_scoring_parameters"> + <param name="struct_weight" argument="struct-weight" + label="Structure weight" type="integer" + value="200" min="0" max="800" /> + <param name="indel_opening" argument="indel-opening" + label="Indel opening score" type="integer" + value="-500" max="0" min="-1500" /> + <param argument="indel" label="Indel score" type="integer" + value="-350" min="-1000" max="0" /> + <param argument="tau" type="integer" value="50" + min="0" max="200" + label="Sequence contribution at structure match in percent"/> + + <conditional name="sequence_score"> + <param name="sequence_score_selector" type="select" label="Type of sequence score contribution"> + <option value="ribofit">Use ribofit</option> + <option value="ribosum">Use RIBOSUM85_60</option> + <option value="match">Simple match/mismatch costs</option> + </param> + <when value="ribofit" /> + <when value="ribosum" /> + <when value="match"> + <param name="match" type="integer" value="50" + min="0" max="400" + label="Match score" /> + <param name="mismatch" type="integer" value="0" + min="-400" max="0" + label="Mismatch score" /> + </when> + </conditional> + </xml> + + <xml name="plfolding_parameters"> + <param name="plfold_span" argument="--plfold-span" + type="integer" value="150" min="-1" max="400" + label="Maximum basepair span by RNAplfold (local folding); -1 for global folding" /> + + <param name="plfold_winsize" argument="--plfold-winsize" + type="integer" value="300" min="-1" max="800" + label="Window size for local folding" /> + </xml> + + <xml name="common_folding_parameters"> + <param name="rnafold_temperature" argument="rnafold-temperature" + type="float" value="37.0" min="10" max="50" + label="Temperature for RNAfold (RNAfold's -T option)" /> + </xml> + + <xml name="common_heuristic_parameters"> + <param name="min_prob" argument="min-prob" type="float" value="0.0005" + min="0.0" max="0.2" + label="Minimal / cutoff probability" /> + + <param name="max_diff_am" argument="max-diff-am" + type="integer" value="30" + min="-1" max="300" + label="Maximal difference for sizes of matched arcs (-1=off)" /> + + <param name="max_diff" argument="max-diff" type="integer" + value="60" min="-1" max="300" + label="Maximal difference for alignment traces (-1=off)" /> + + <param name="max_diff_at_am" argument="max-diff-am" type="integer" + value="-1" min="-1" max="300" + label="Maximal difference for alignment traces, only at arc match positions" /> + + <param name="max_bps_length_ratio" argument="max-bps-length-ratio" + type="float" value="0.0" min="0.0" max="1.0" + label="Maximal ratio of #base pairs divided by sequence length (default: no effect)" /> + </xml> + + <xml name="alifold_consensus_parameter"> + <param name="alifold_consensus_dp" argument="alifold-consensus-dp" + type="boolean" checked="false" + truevalue="--alifold-consensus-dp" falsevalue="" + label="Compute consensus dot plot by alifold" /> + </xml> + + <xml name="constraints"> + <param name="lonely_pairs" type="boolean" truevalue="--LP" falsevalue="--noLP" + checked="false" label="Allow lonely base-pairs" help="(--LP/--noLP)" /> + <param name="maxBPspan" argument="--maxBPspan" + type="integer" value="-1" min="-1" max="400" + label="Maximum basepair span by RNAfold; -1 for arbitrary span" /> + <param name="ignore_constraints" argument="ignore-constraints" + type="boolean" checked="false" truevalue="--ignore-constraints" falsevalue="" + help="Ignore all anchor and structure constraints given + in the fasta(-ish) input." /> + </xml> + + <xml name="common_other_parameters"> + </xml> + + <xml name="common_outputs"> + <data format="txt" name="stdout" label="${tool.name} std out on ${on_string}"> + <filter>stdout_verbosity != '--quiet'</filter> + </data> + <data format="clustal" name="clustal" from_work_dir="mlocarna_results/results/result.aln" + label="${tool.name} alignment (annotated clustal) on ${on_string}"> + <filter>'clustal' in outputs</filter> + </data> + <data format="clustal" name="clustal_strict" + from_work_dir="mlocarna_results/results/result.strict-aln" + label="${tool.name} alignment (clustal) on ${on_string}"> + <filter>'clustal_strict' in outputs</filter> + </data> + <data format="stockholm" name="stockholm" from_work_dir="mlocarna_results/results/result.stk" + label="${tool.name} alignment (stockholm) on ${on_string}"> + <filter>'stockholm' in outputs</filter> + </data> + <data format="txt" name="pp" + from_work_dir="mlocarna_results/results/result.pp" + label="${tool.name} alignment (PP 2.0) on ${on_string}"> + <filter>'pp' in outputs</filter> + </data> + <data format="tar.gz" name="mlocarna_results_tgz" + label="${tool.name} results archive on ${on_string}"> + <filter>'mlocarna_results' in outputs</filter> + </data> + </xml> + + <xml name="citations"> + <citations> + <citation + type="doi">10.1371/journal.pcbi.0030065</citation> + <citation type="doi">10.1261/rna.029041.111</citation> + </citations> + </xml> + + + +</macros> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea-default.stdout Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,18 @@ +mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0 +Copyright Sebastian Will + +Compute pair probs ... +Compute pairwise alignments ... +Perform progressive alignment ... + + + +vhuU AG-CUCACAACCGAACCC-AU------------UUGGGAGGUUGUGAGCU- +fwdB AU-GUUGGAGGGGAACCC-GU------------AAGGGACCCUCCAAGAU- +selD UUACGAUGUGCCGAACCCUUU------------AAGGGAGGCACAUCGAAA +hdrA GG--CACCACUCGAAGGC--U------------AAGCCAAAGUGGUG-CU- +vhuD GU--UCUCUCGGGAACCCGUC------------AAGGGACCGAGAGA-AC- +fruA ---CCUCGAGGGGAACCC-GA------------AAGGGACCCGAGAGG--- +fdhA CG-CCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGGCG- + +alifold ((.(((((((((...(((.................))).))))))))))). (-31.59 = -20.01 + -11.58)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea-probabilistic.aln Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,11 @@ +CLUSTAL W --- LocARNA 1.9.0 + + + +selD UUACGAUGUGCCGAACCCUU------------UAAGGGAGGCACAUCGAAA +vhuU AGC-UCACAACCGAACCCAU-------------UUGGGAGGUUGUGAG-CU +fwdB AUG-UUGGAGGGGAACCCGU-------------AAGGGACCCUCCAAG-AU +hdrA GGC-ACC-ACUCGAAGGCU--------------AAGCCAAAGU-GGUG-CU +vhuD GUU-CUC-UCGGGAACCCGU------------CAAGGGACCGA-GAGA-AC +fdhA CGC-CACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAG-GUGG-CG +fruA CC-UCG--AGGGGAACCCGA-------------AAGGGACCC--GAGA-GG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea.fa Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,14 @@ +>fruA +CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG +>fdhA +CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG +>vhuU +AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU +>hdrA +GGCACCACUCGAAGGCUAAGCCAAAGUGGUGCU +>vhuD +GUUCUCUCGGGAACCCGUCAAGGGACCGAGAGAAC +>selD +UUACGAUGUGCCGAACCCUUUAAGGGAGGCACAUCGAAA +>fwdB +AUGUUGGAGGGGAACCCGUAAGGGACCCUCCAAGAU
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/archaea_relplot.scr Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,137 @@ +pdf("/tmp/tmp5yxSuG/files/000/dataset_2.dat",width=12,height=4,version="1.4") + +rel <- read.table("mlocarna_results/results/result.bmreliability"); +seqrel <- rel[[2]] +strrel <- rel[[3]] + +if ("" != "") { + seq <- "" + seq <- strsplit(seq,split="") + tab <- unlist(seq)!="-" + + seqrel<-seqrel[tab] + strrel<-strrel[tab] +} + +len<-length(seqrel) + +if (0) { + seqrel<-seqrel[len:1] + strrel<-strrel[len:1] +} + + + +if (1) { + seqrel <- seqrel/1.0 +} + + +totalrel <- seqrel+strrel; + +anno_space<-0.075 + +maxy <- max(c(1,totalrel))+anno_space*(0+1); + + +firstpos <- 1 +lastpos <- 1+len-1 + +if (0) { + the_xlim <- c(lastpos,firstpos) +} else { + the_xlim <- c(firstpos,lastpos) +} + +# set margin +# b, l, t, r +par(mar=c(6,2.5,1,1)) + +# open plot (and draw threshold) +plot(c(0),c(0),type="l", + xlab="",ylab="", + xlim=the_xlim,ylim=c(0,maxy), + yaxp=c(0,1,2)) + +## title inside of plot +legend("topleft","",bty="n") + + +# total reliability +polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,totalrel,0),col=rgb(0.8,0.8,0.9,0.5),lwd=2,border=FALSE) +lines(firstpos:lastpos,totalrel,col="blue",lwd=2) + +# plot structure reliability +polygon(c(firstpos,firstpos:lastpos,lastpos),c(0,strrel,0),col=rgb(0.3,0.3,0.5,0.8),lwd=1,border=FALSE) + + +## draw other signals +signals<-c(); +signal_sizes<-c(); + +signal_starts <- 1:0 + +signal_starts[1]<-1; +if (0>1) { + for (i in 2:0) { + signal_starts[i]<-signal_starts[i-1]+signal_sizes[i-1]*2+1; + } +} + +colors <- c( + rgb(0.6,0.1,0.1,0.9), + rgb(0.6,0.6,0.1,0.9), + rgb(0.1,0.6,0.6,0.9), + rgb(0.6,0.1,0.6,0.9) +); +colors<-c(colors,colors); + +if (0>0) { + + for (i in 1:0) { + orientation <- signals[signal_starts[i]+signal_sizes[i]*2]; + sig_y <- maxy-i*anno_space; + + for (j in 0:(signal_sizes[i]-1)) { + + sig_x <- c(signals[signal_starts[i]+j*2],signals[signal_starts[i]+j*2+1]); + + ## draw arrows + if (orientation!=0) { + the_code <- 1+(orientation+1)/2; + arrows(sig_x[1],sig_y,sig_x[2],sig_y,lwd=4,col=colors[i],code=the_code,angle=20,length=0.15); + } else { + lines(sig_x,c(sig_y,sig_y),lwd=4,col=colors[i]); + } + } + } +} + +#draw inferred on-signal +hit_color <- rgb(0.1,0.6,0.1,0.9) + +if (0!=1) { + + on <- c(0,4,33,44,49); + off <- c(3,20,43,48,51); + + if (length(on)>0) { + for (i in 1:length(on)) { + lines(c(1+on[i],1+off[i]-1),c(maxy,maxy),lwd=7,col=hit_color); + } + } + + ### draw on/off values + if (0) { + lines(c(1,1+len),c(0.0355791,0.0355791),lty=2,lwd=1) + lines(c(1,1+len),c(0.702675,0.702675),lty=2,lwd=1) + } +} + + +signal_names<-c(); + +if (length(signal_names)>0 || (0!=1)) { + legend("bottom",c("LocARNA",signal_names),lwd=7,col=c(hit_color,colors),horiz=TRUE,inset=-0.4); + # ,xpd=TRUE +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA-default.stdout Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,33 @@ +mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.9.0 +Copyright Sebastian Will + +Compute pair probs ... +Compute pairwise alignments ... +Perform progressive alignment ... + + + +ACA7 ACCUCCUGGGAUCGCAUCUGG-AGAGUGC---CUAGUAUUCUGCCAGCUUCGGAA-AGGG +ACA30 UGGCACUUUCACAG--UUCCU-UCCCCAG---GCAGUGGGGCCAGGAUUUGGUAGCUGGU +ACA5 UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAA--GGC +ACA59 GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGG-CCCAUGGGUGAC--CCU +#A1 ............................................................ +#A2 ............................................................ + +ACA7 AGGGAAAGCAAGCCUGGCAGAG-GCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCG +ACA30 GCUGAGAGAAAAC---CC-UUG---AUUGUAUUCUUGCCCUGGG---AUUAUACCAGUGG +ACA5 UGCCACAGAAACAC--UGUGAC-UCAUGG-----GCCCUGUUCCUGUGUCCCAGGCUCAG +ACA59 GGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUA +#A1 ....AAAAAA.................................................. +#A2 ....123456.................................................. + +ACA7 AUUGGA--AGA---CACU-CUGCG-----ACA +ACA30 CAACUG--UCA---CUCA-AUGGG-----ACA +ACA5 GGAUAA--AUU---UGGU-UACAG-----ACA +ACA59 ACAAUACUUACUCUCGUUGGUGAUAAGGAACA +#A1 .............................BBB +#A2 .............................123 + +alifold .((((((((........((((.(((((((......))))))).))))......))..))) + ))).............((((((.....((.....((((((((((((.....))))))))) + )))......)).....)).))))......... (-61.69 = -33.85 + -27.84)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA.fa Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,21 @@ +>ACA59 +GCCCAGGGUAUGUUCACGGGGCGAUGCUGCCCUCCCAGCUGGCCCAUGGGUGACCCUGGGAACAUUAACUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACA +.............................................................xxxxxx...............................................................................xxx #S +.............................................................AAAAAA...............................................................................BBB #1 +.............................................................123456...............................................................................123 #2 + +>ACA7 +ACCUCCUGGGAUCGCAUCUGGAGAGUGCCUAGUAUUCUGCCAGCUUCGGAAAGGGAGGGAAAGCAAGCCUGGCAGAGGCACCCAUUCCAUUCCCAGCUUGCUCCGUAGCUGGCGAUUGGAAGACACUCUGCGACA +...........................................................xxxxxx...................................................................xxx #S +...........................................................AAAAAA...................................................................BBB #1 +...........................................................123456...................................................................123 #2 +>ACA5 +UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAAGGCUGCCACAGAAACACUGUGACUCAUGGGCCCUGUUCCUGUGUCCCAGGCUCAGGGAUAAAUUUGGUUACAGACA +..............................................................xxxxxx............................................................xxx #S +..............................................................AAAAAA............................................................BBB #1 +..............................................................123456............................................................123 #2 +>ACA30 +UGGCACUUUCACAGUUCCUUCCCCAGGCAGUGGGGCCAGGAUUUGGUAGCUGGUGCUGAGAGAAAACCCUUGAUUGUAUUCUUGCCCUGGGAUUAUACCAGUGGCAACUGUCACUCAAUGGGACA +..........................................................xxxxxx..........................................................xxx #S +..........................................................AAAAAA..........................................................BBB #1 +..........................................................123456..........................................................123 #2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/haca.snoRNA_anchor.bed Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,8 @@ +ACA59 61 67 ANANNA +ACA7 59 65 ANANNA +ACA5 62 68 ANANNA +ACA30 58 64 ANANNA +ACA59 146 149 ACA +ACA7 132 135 ACA +ACA5 128 131 ACA +ACA30 122 125 ACA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2-1.fa Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,2 @@ +>D10744 +GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2-2.fa Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,2 @@ +>AF008220 +GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_2.aln Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,7 @@ +CLUSTAL W --- LocARNA 1.9.0 --- Score: 2875 + +D10744 GGAAAAUU-GAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGG +AF008220 GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGG-----------UCG + +D10744 UGAGUUCGAAUCUCACAUUUUCCG +AF008220 GCGGUUCGAGCCCGUCAUCCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tRNA_5.fa Wed Dec 28 18:48:14 2016 -0500 @@ -0,0 +1,10 @@ +>D10744 +GGAAAAUUGAUCAUCGGCAAGAUAAGUUAUUUACUAAAUAAUAGGAUUUAAUAACCUGGUGAGUUCGAAUCUCACAUUUUCCG +>AF008220 +GGAGGAUUAGCUCAGCUGGGAGAGCAUCUGCCUUACAAGCAGAGGGUCGGCGGUUCGAGCCCGUCAUCCUCCA +>Z11880 +GCCUUCCUAGCUCAGUGGUAGAGCGCACGGCUUUUAACCGUGUGGUCGUGGGUUCGAUCCCCACGGAAGGCG +>X02172 +GCCUUUAUAGCUUAGUGGUAAAGCGAUAAACUGAAGAUUUAUUUACAUGUAGUUCGAUUCUCAUUAAGGGCA +>M68929 +GCGGAUAUAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAAUCCCGUUAUUCGCC