Mercurial > repos > bgruening > trna_prediction

comparison tRNAscan.xml @ 2:358f58401cd6 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44
author bgruening
date Wed, 26 Jul 2017 10:14:05 -0400
parents d788d1abe238
children
comparison
equal deleted inserted replaced
1:d788d1abe238 2:358f58401cd6
1 <tool id="trnascan" name="tRNA prediction" version="0.3"> 1 <tool id="trnascan" name="tRNA prediction" version="0.4">
2 <description>(tRNAscan)</description> 2 <description>(tRNAscan)</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.3.1">tRNAscan-SE</requirement> 4 <requirement type="package" version="1.3.1">trnascan-se</requirement>
5 <requirement type="package" version="1.61">biopython</requirement> 5 <requirement type="package" version="1.0.2">infernal</requirement>
6 <requirement type="package" version="1.70">biopython</requirement>
7 <requirement type="package" version="2.7">python</requirement>
6 </requirements> 8 </requirements>
7 <command interpreter="python"> 9 <command>
8 <![CDATA[ 10 <![CDATA[
9 tRNAscan.py 11 python '$__tool_directory__/tRNAscan.py'
10 $organism 12 #if $organism
11 $mode 13 $organism
12 $showPrimSecondOpt 14 #end if
13 $disablePseudo 15 #if $mode
14 $showCodons 16 $mode
15 -o 17 #end if
16 $tabular_output 18 #if $showPrimSecondOpt
17 $inputfile 19 $showPrimSecondOpt
18 $fasta_output 20 #end if
19 ]]> 21 #if $disablePseudo
22 $disablePseudo
23 #end if
24 #if $showCodons
25 $showCodons
26 #end if
27 -o
28 '$tabular_output'
29 '$inputfile'
30 '$fasta_output'
31 ]]>
20 </command> 32 </command>
21 <inputs> 33 <inputs>
22 <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/> 34 <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
23 <param name="organism" type="select" label="Select Organism"> 35 <param name="organism" type="select" label="Select Organism">
24 <option value="">Eukaryotic</option> 36 <option value="" selected="true">Eukaryotic</option>
25 <option value="-G">general tRNA model</option> 37 <option value="-G">general tRNA model</option>
26 <option value="-B">Bacterial</option> 38 <option value="-B">Bacterial</option>
27 <option value="-A">Archaeal</option> 39 <option value="-A">Archaeal</option>
28 <option value="-O">Mitochondrial/Chloroplast</option> 40 <option value="-O">Mitochondrial/Chloroplast</option>
29 </param> 41 </param>
30 <param name="mode" type="select" label="Select Mode"> 42 <param name="mode" type="select" label="Select Mode">
31 <option value="">Default</option> 43 <option value="" selected="true">Default</option>
32 <option value="-C">Covariance model analysis only (slow)</option> 44 <option value="-C">Covariance model analysis only (slow)</option>
33 <option value="-T">tRNAscan only</option> 45 <option value="-T">tRNAscan only</option>
34 <option value="-E">EufindtRNA only</option> 46 <option value="-E">EufindtRNA only</option>
35 <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> 47 <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option>
36 <option value="--newscan">Infernal and new cm models</option> 48 <option value="--newscan">Infernal and new cm models</option>
37 </param> 49 </param>
38 <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" /> 50 <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" />
39 <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" /> 51 <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" />
40 <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" /> 52 <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" />
43 <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" /> 55 <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" />
44 <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" /> 56 <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" />
45 </outputs> 57 </outputs>
46 <tests> 58 <tests>
47 <test> 59 <test>
48 <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> 60 <param name="inputfile" value="trna_arabidopsis.fasta" ftype="fasta" />
49 <param name="organism" value="" /> 61 <param name="organism" value="" />
50 <param name="mode" value="--infernal" /> 62 <param name="mode" value="--infernal" /> <!-- Infernal test not working due to cmsearch error-->
51 <param name="disablePseudo" value="" /> 63 <param name="disablePseudo" value="" />
52 <param name="showPrimSecondOpt" value="" /> 64 <param name="showPrimSecondOpt" value="" />
53 <param name="showCodons" value="" /> 65 <param name="showCodons" value="" />
54 <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.fasta" ftype="fasta" /> 66 <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.fasta" ftype="fasta" />
55 <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" /> 67 <output name="tabular_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" />
56 </test> 68 </test>
57 </tests> 69 </tests>
58 <help> 70 <help>
59 <![CDATA[ 71 <![CDATA[
60 72
61 73
62 .. class:: warningmark
63
64 **TIP** This tool requires *fasta* formated sequences.
65
66 -----
67
68 **What it does** 74 **What it does**
69 75
70 tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic 76 tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic
71 sequence feasible using the selectivity of the Cove analysis package. 77 sequence feasible using the selectivity of the Cove analysis package.
72 We have optimized search sensitivity with eukaryote cytoplasmic and 78 We have optimized search sensitivity with eukaryote cytoplasmic and
73 eubacterial sequences, but it may be applied more broadly with a 79 eubacterial sequences, but it may be applied more broadly with a
74 slight reduction in sensitivity. 80 slight reduction in sensitivity.
75 81
76 .. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/ 82 .. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/
77 83
78 ----- 84 **Input**
85
86 Nucleotide sequence in FASTA format.
87
79 88
80 **Organism** 89 **Organism**
81 90
82 - search for eukaryotic cytoplasmic tRNAs: 91 - search for eukaryotic cytoplasmic tRNAs:
83 92
84 This is the default. 93 This is the default.
85 94
86 - use general tRNA model: 95 - use general tRNA model:
87 96
88 This option selects the general tRNA covariance model that was trained 97 This option selects the general tRNA covariance model that was trained
89 on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and 98 on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
90 Eukarya). This mode can be used when analyzing a mixed collection of 99 Eukarya). This mode can be used when analyzing a mixed collection of
91 sequences from more than one phylogenetic domain, with only slight 100 sequences from more than one phylogenetic domain, with only slight
92 loss of sensitivity and selectivity. The original publication 101 loss of sensitivity and selectivity. The original publication
93 describing this program and tRNAscan-SE version 1.0 used this general 102 describing this program and tRNAscan-SE version 1.0 used this general
94 tRNA model exclusively. If you wish to compare scores to those found 103 tRNA model exclusively. If you wish to compare scores to those found
95 in the paper or scans using v1.0, use this option. Use of this option 104 in the paper or scans using v1.0, use this option. Use of this option
96 is compatible with all other search mode options described in this 105 is compatible with all other search mode options described in this
97 section. 106 section.
98 107
99 - search for bacterial tRNAs 108 - search for bacterial tRNAs
100 109
101 This option selects the bacterial covariance model for tRNA analysis, 110 This option selects the bacterial covariance model for tRNA analysis,
102 and loosens the search parameters for EufindtRNA to improve detection 111 and loosens the search parameters for EufindtRNA to improve detection
103 of bacterial tRNAs. Use of this mode with bacterial sequences 112 of bacterial tRNAs. Use of this mode with bacterial sequences
104 will also improve bounds prediction of the 3' end (the terminal CAA 113 will also improve bounds prediction of the 3' end (the terminal CAA
105 triplet). 114 triplet).
106 115
107 - search for archaeal tRNAs 116 - search for archaeal tRNAs
108 117
109 This option selects an archaeal-specific covariance model for tRNA 118 This option selects an archaeal-specific covariance model for tRNA
110 analysis, as well as slightly loosening the EufindtRNA search 119 analysis, as well as slightly loosening the EufindtRNA search
111 cutoffs. 120 cutoffs.
112 121
113 - search for organellar (mitochondrial/chloroplast) tRNAs 122 - search for organellar (mitochondrial/chloroplast) tRNAs
114 123
115 This parameter bypasses the fast first-pass scanners that are poor at 124 This parameter bypasses the fast first-pass scanners that are poor at
116 detecting organellar tRNAs and runs Cove analysis only. Since true 125 detecting organellar tRNAs and runs Cove analysis only. Since true
117 organellar tRNAs have been found to have Cove scores between 15 and 20 126 organellar tRNAs have been found to have Cove scores between 15 and 20
118 bits, the search cutoff is lowered from 20 to 15 bits. Also, 127 bits, the search cutoff is lowered from 20 to 15 bits. Also,
119 pseudogene checking is disabled since it is only applicable to 128 pseudogene checking is disabled since it is only applicable to
120 eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is 129 eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
121 used, searches will be very slow (see -C option below) relative to the 130 used, searches will be very slow (see -C option below) relative to the
122 default mode. 131 default mode.
123 132
124 ------ 133
125 134
126 **Mode** 135 **Mode**
127 136
128 - search using Cove analysis only (max sensitivity, slow) 137 - search using Cove analysis only (max sensitivity, slow)
129 138
130 Directs tRNAscan-SE to analyze sequences using Cove analysis only. 139 Directs tRNAscan-SE to analyze sequences using Cove analysis only.
131 This option allows a slightly more sensitive search than the default 140 This option allows a slightly more sensitive search than the default
132 tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250 141 tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
133 to 3,000 fold). Output format and other program defaults are 142 to 3,000 fold). Output format and other program defaults are
134 otherwise identical to the normal analysis. 143 otherwise identical to the normal analysis.
135 144
136 - search using Eukaryotic tRNA finder (EufindtRNA) only: 145 - search using Eukaryotic tRNA finder (EufindtRNA) only:
137 146
138 This option runs EufindtRNA alone to search for tRNAs. Since Cove is 147 This option runs EufindtRNA alone to search for tRNAs. Since Cove is
139 not being used as a secondary filter to remove false positives, this 148 not being used as a secondary filter to remove false positives, this
140 run mode defaults to "Normal" parameters which more closely 149 run mode defaults to "Normal" parameters which more closely
141 approximates the sensitivity and selectivity of the original algorithm 150 approximates the sensitivity and selectivity of the original algorithm
142 describe by Pavesi and colleagues. 151 describe by Pavesi and colleagues.
143 152
144 - search using tRNAscan only (defaults to strict search parameters) 153 - search using tRNAscan only (defaults to strict search parameters)
145 154
146 Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This 155 Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
147 mode will cause tRNAscan to default to using "strict" parameters 156 mode will cause tRNAscan to default to using "strict" parameters
148 (similar to tRNAscan version 1.3 operation). This mode of operation 157 (similar to tRNAscan version 1.3 operation). This mode of operation
149 is faster (about 3-5 times faster than default mode analysis), but 158 is faster (about 3-5 times faster than default mode analysis), but
150 will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp, 159 will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
151 decreased sensitivity, and less reliable prediction of anticodons, 160 decreased sensitivity, and less reliable prediction of anticodons,
152 tRNA isotype, and introns. 161 tRNA isotype, and introns.
153 162
154 - search using Infernal cm analysis only (max sensitivity, very slow) 163 - search using Infernal cm analysis only (max sensitivity, very slow)
155 164
156 165
157 - search using Infernal and new cm models instead of Cove 166 - search using Infernal and new cm models instead of Cove
158 167
159 168
160 -----
161 169
162 **disable pseudogene checking** 170 **disable pseudogene checking**
163 171
164 Manually disable checking tRNAs for poor primary or secondary 172 Manually disable checking tRNAs for poor primary or secondary
165 structure scores often indicative of eukaryotic pseudogenes. This 173 structure scores often indicative of eukaryotic pseudogenes. This
166 will slightly speed the program and may be necessary for non-eukaryotic 174 will slightly speed the program and may be necessary for non-eukaryotic
167 sequences that are flagged as possible pseudogenes but are known to be 175 sequences that are flagged as possible pseudogenes but are known to be
168 functional tRNAs. 176 functional tRNAs.
169 177
170 -----
171 178
172 **Show both primary and secondary structure score components to covariance model bit scores** 179 **Show both primary and secondary structure score components to covariance model bit scores**
173 180
174 This option displays the breakdown of the two components of the 181 This option displays the breakdown of the two components of the
175 covariance model bit score. Since tRNA pseudogenes often have one 182 covariance model bit score. Since tRNA pseudogenes often have one
176 very low component (good secondary structure but poor primary sequence 183 very low component (good secondary structure but poor primary sequence
177 similarity to the tRNA model, or vice versa), this information may be 184 similarity to the tRNA model, or vice versa), this information may be
178 useful in deciding whether a low-scoring tRNA is likely to be a 185 useful in deciding whether a low-scoring tRNA is likely to be a
179 pseudogene. The heuristic pseudogene detection filter uses this 186 pseudogene. The heuristic pseudogene detection filter uses this
180 information to flag possible pseudogenes -- use this option to see why 187 information to flag possible pseudogenes -- use this option to see why
181 a hit is marked as a possible pseudogene. The user may wish to 188 a hit is marked as a possible pseudogene. The user may wish to
182 examine score breakdowns from known tRNAs in the organism of interest 189 examine score breakdowns from known tRNAs in the organism of interest
183 to get a frame of reference. 190 to get a frame of reference.
184 191
185 ----- 192
186 193
187 **Show codons instead of tRNA anticodons** 194 **Show codons instead of tRNA anticodons**
188 195
189 This option causes tRNAscan-SE to output a tRNA's corresponding codon 196 This option causes tRNAscan-SE to output a tRNA's corresponding codon
190 in place of its anticodon. 197 in place of its anticodon.
191 198
192 ----- 199
193 200
194 **Example** 201 **Example**
195 202
196 * input: 203 **input**
197 204
198 >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 205 >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7
199 GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT 206 GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
200 GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT 207 GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
201 TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT 208 TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
202 TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC 209 TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
203 GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA 210 GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
204 ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG 211 ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
205 AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA 212 AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
206 ..... 213 .....
207 214
208 215
209 * output: 216 **output**
210 217
211 218
212 ======== ====== ===== ====== ==== ========== ====== ====== ========== ========== 219 ======== ====== ===== ====== ==== ========== ====== ====== ========== ==========
213 tRNA Bounds Intron Bonds 220 tRNA Bounds Intron Bonds
214 -------- ------ ---------------- ---- ---------- ---------------- ---------- ---------- 221 -------- ------ ---------------- ---- ---------- ---------------- ---------- ----------
220 CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo 227 CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo
221 CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo 228 CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo
222 ======== ====== ===== ====== ==== ========== ====== ====== ========== ========== 229 ======== ====== ===== ====== ==== ========== ====== ====== ========== ==========
223 230
224 231
225 -------
226
227 **References**
228
229 Todd M. Lowe and Sean R. Eddy
230
231 tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
232
233 doi:10.1093/nar/25.5.0955
234
235
236 ]]> 232 ]]>
237 </help> 233 </help>
234 <citations>
235 <citation type="doi">10.1093/nar/25.5.0955</citation>
236 </citations>
238 </tool> 237 </tool>