Mercurial > repos > bgruening > trna_prediction
comparison test-data/aragorn_tansl-table-1_tmRNA_tRNA.txt @ 2:358f58401cd6 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44
author | bgruening |
---|---|
date | Wed, 26 Jul 2017 10:14:05 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
1:d788d1abe238 | 2:358f58401cd6 |
---|---|
1 ------------------------------ | |
2 ARAGORN v1.2.36 Dean Laslett | |
3 ------------------------------ | |
4 | |
5 Please reference the following paper if you use this | |
6 program as part of any published research. | |
7 | |
8 Laslett, D. and Canback, B. (2004) ARAGORN, a | |
9 program for the detection of transfer RNA and | |
10 transfer-messenger RNA genes in nucleotide sequences. | |
11 Nucleic Acids Research, 32;11-16. | |
12 | |
13 | |
14 Searching for tRNA genes with no introns | |
15 Searching for tmRNA genes | |
16 Assuming circular topology, search wraps around ends | |
17 Searching both strands | |
18 Using standard genetic code | |
19 | |
20 | |
21 gi|240255695:23036500-23037000 Arabidopsis thaliana chromosome 3, complete sequence | |
22 501 nucleotides in sequence | |
23 Mean G+C content = 43.1% | |
24 | |
25 1. | |
26 | |
27 | |
28 | |
29 a | |
30 g-c | |
31 g-c | |
32 g+t | |
33 g-c | |
34 a-t | |
35 t-a | |
36 g-c tt | |
37 t gtccc a | |
38 ta a !!!!! g | |
39 a ctcg caggg c | |
40 t !!!! a tt | |
41 g gagc c | |
42 gta g g | |
43 c-gag | |
44 t-a | |
45 c-g | |
46 g-c | |
47 c-g | |
48 t t | |
49 t a | |
50 tgc | |
51 | |
52 | |
53 | |
54 tRNA-Ala(tgc) | |
55 73 bases, %GC = 56.2 | |
56 Sequence [381,453] | |
57 | |
58 | |
59 | |
60 >tRNA-Ala(tgc) [381,453] | |
61 ggggatgtagctcatatggtagagcgctcgctttgcatgcgagaggcaca | |
62 gggttcgattccctgcatctcca | |
63 | |
64 | |
65 | |
66 | |
67 Number of tmRNA genes = 0 | |
68 | |
69 | |
70 Configuration: aragorn /tmp/tmpx1qAPk/files/000/dataset_3.dat -gc1 -m -t -c -o /tmp/tmpx1qAPk/files/000/dataset_4.dat -fasta |