--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.xml	Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,234 @@
+<tool id="trnascan" name="tRNA prediction" version="0.3">
+    <description>(tRNAscan)</description>
+    <requirements>
+        <requirement type="package" version="1.3.1">tRNAscan-SE</requirement>
+        <requirement type="package" version="1.61">biopython</requirement>
+    </requirements>
+    <command interpreter="python">
+        tRNAscan.py
+            $organism
+            $mode
+            $showPrimSecondOpt
+            $disablePseudo
+            $showCodons
+            -o
+            $tabular_output
+            $inputfile
+            $fasta_output
+    </command>
+    <inputs>
+        <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
+        <param name="organism" type="select" label="Select Organism">
+            <option value="">Eukaryotic</option>
+            <option value="-G">general tRNA model</option>
+            <option value="-B">Bacterial</option>
+            <option value="-A">Archaeal</option>
+            <option value="-O">Mitochondrial/Chloroplast</option>
+        </param>
+        <param name="mode" type="select" label="Select Mode">
+            <option value="">Default</option>
+            <option value="-C">Covariance model analysis only (slow)</option>
+            <option value="-T">tRNAscan only</option>
+            <option value="-E">EufindtRNA only</option>
+            <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option>
+            <option value="--newscan">Infernal and new cm models</option>
+        </param>
+        <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" />
+        <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" />
+        <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" />
+    </inputs>
+    <outputs>
+        <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" />
+        <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" />
+            <param name="organism" value="" />
+            <param name="mode" value="--infernal" />
+            <param name="disablePseudo" value="" />
+            <param name="showPrimSecondOpt" value="" />
+            <param name="showCodons" value="" />
+            <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.fasta" ftype="fasta" />
+            <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" />
+        </test>
+    </tests>
+    <help>
+
+
+.. class:: warningmark
+
+**TIP** This tool requires *fasta* formated sequences.
+
+-----
+
+**What it does**
+
+	tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic
+	sequence feasible using the selectivity of the Cove analysis package.
+	We have optimized search sensitivity with eukaryote cytoplasmic and
+	eubacterial sequences, but it may be applied more broadly with a
+	slight reduction in sensitivity.
+
+.. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/
+
+-----
+
+**Organism**
+
+- search for eukaryotic cytoplasmic tRNAs:
+
+    This is the default.
+
+- use general tRNA model:
+
+	This option selects the general tRNA covariance model that was trained
+	on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
+	Eukarya). This mode can be used when analyzing a mixed collection of
+	sequences from more than one phylogenetic domain, with only slight
+	loss of sensitivity and selectivity. The original publication
+	describing this program and tRNAscan-SE version 1.0 used this general
+	tRNA model exclusively. If you wish to compare scores to those found
+	in the paper or scans using v1.0, use this option. Use of this option
+	is compatible with all other search mode options described in this
+	section.
+
+- search for bacterial tRNAs
+
+	This option selects the bacterial covariance model for tRNA analysis,
+	and loosens the search parameters for EufindtRNA to improve detection
+	of bacterial tRNAs. Use of this mode with bacterial sequences
+	will also improve bounds prediction of the 3' end (the terminal CAA
+	triplet).
+
+- search for archaeal tRNAs
+
+	This option selects an archaeal-specific covariance model for tRNA
+	analysis, as well as slightly loosening the EufindtRNA search
+	cutoffs.
+
+- search for organellar (mitochondrial/chloroplast) tRNAs
+
+	This parameter bypasses the fast first-pass scanners that are poor at
+	detecting organellar tRNAs and runs Cove analysis only. Since true
+	organellar tRNAs have been found to have Cove scores between 15 and 20
+	bits, the search cutoff is lowered from 20 to 15 bits. Also,
+	pseudogene checking is disabled since it is only applicable to
+	eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
+	used, searches will be very slow (see -C option below) relative to the
+	default mode.
+
+------
+
+**Mode**
+
+- search using Cove analysis only (max sensitivity, slow)
+
+	Directs tRNAscan-SE to analyze sequences using Cove analysis only.
+	This option allows a slightly more sensitive search than the default
+	tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
+	to 3,000 fold). Output format and other program defaults are
+	otherwise identical to the normal analysis.
+
+- search using Eukaryotic tRNA finder (EufindtRNA) only:
+
+	This option runs EufindtRNA alone to search for tRNAs. Since Cove is
+	not being used as a secondary filter to remove false positives, this
+	run mode defaults to "Normal" parameters which more closely
+	approximates the sensitivity and selectivity of the original algorithm
+	describe by Pavesi and colleagues.
+
+- search using tRNAscan only (defaults to strict search parameters)
+
+	Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
+	mode will cause tRNAscan to default to using "strict" parameters
+	(similar to tRNAscan version 1.3 operation). This mode of operation
+	is faster (about 3-5 times faster than default mode analysis), but
+	will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
+	decreased sensitivity, and less reliable prediction of anticodons,
+	tRNA isotype, and introns.
+
+- search using Infernal cm analysis only (max sensitivity, very slow)
+
+
+- search using Infernal and new cm models instead of Cove
+
+
+-----
+
+**disable pseudogene checking**
+
+	Manually disable checking tRNAs for poor primary or secondary
+	structure scores often indicative of eukaryotic pseudogenes. This
+	will slightly speed the program and may be necessary for non-eukaryotic
+	sequences that are flagged as possible pseudogenes but are known to be
+	functional tRNAs.
+
+-----
+
+**Show both primary and secondary structure score components to covariance model bit scores**
+
+	This option displays the breakdown of the two components of the
+	covariance model bit score. Since tRNA pseudogenes often have one
+	very low component (good secondary structure but poor primary sequence
+	similarity to the tRNA model, or vice versa), this information may be
+	useful in deciding whether a low-scoring tRNA is likely to be a
+	pseudogene. The heuristic pseudogene detection filter uses this
+	information to flag possible pseudogenes -- use this option to see why
+	a hit is marked as a possible pseudogene. The user may wish to
+	examine score breakdowns from known tRNAs in the organism of interest 
+	to get a frame of reference.
+
+-----
+
+**Show codons instead of tRNA anticodons**
+
+	This option causes tRNAscan-SE to output a tRNA's corresponding codon
+	in place of its anticodon.
+
+-----
+
+**Example**
+
+* input:
+
+	>CELF22B7  C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+	GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+	GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+	TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+	TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+	GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+	ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+	AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+	.....
+
+
+* output:
+
+
+    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========
+                              tRNA Bounds                              Intron Bonds                              
+    --------     ------    ----------------    ----    ----------    ----------------    ----------    ----------
+    Name         # tRNA    Begin     End       tRNA    Anti Codon    Begin     End       Cove Score    Hit Origin
+    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========
+    CELF22B7     1         12619     12738     Leu     CAA           12657     12692     55.12         Bo
+    CELF22B7     2         19480     19561     Ser     AGA           0         0         66.90         Bo
+    CELF22B7     3         26367     26439     Phe     GAA           0         0         73.88         Bo
+    CELF22B7     4         26992     26920     Phe     GAA           0         0         73.88         Bo
+    CELF22B7     5         23765     23694     Pro     CGG           0         0         60.58         Bo
+    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========
+
+
+-------
+
+**References**
+
+Todd M. Lowe and Sean R. Eddy
+
+tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
+
+doi:10.1093/nar/25.5.0955 
+
+
+    </help>
+</tool>