Mercurial > repos > bgruening > trna_prediction
diff tRNAscan.xml @ 2:358f58401cd6 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44
| author | bgruening |
|---|---|
| date | Wed, 26 Jul 2017 10:14:05 -0400 |
| parents | d788d1abe238 |
| children |
line wrap: on
line diff
--- a/tRNAscan.xml Thu Jan 22 13:15:51 2015 -0500 +++ b/tRNAscan.xml Wed Jul 26 10:14:05 2017 -0400 @@ -1,38 +1,50 @@ -<tool id="trnascan" name="tRNA prediction" version="0.3"> +<tool id="trnascan" name="tRNA prediction" version="0.4"> <description>(tRNAscan)</description> <requirements> - <requirement type="package" version="1.3.1">tRNAscan-SE</requirement> - <requirement type="package" version="1.61">biopython</requirement> + <requirement type="package" version="1.3.1">trnascan-se</requirement> + <requirement type="package" version="1.0.2">infernal</requirement> + <requirement type="package" version="1.70">biopython</requirement> + <requirement type="package" version="2.7">python</requirement> </requirements> - <command interpreter="python"> -<![CDATA[ - tRNAscan.py - $organism - $mode - $showPrimSecondOpt - $disablePseudo - $showCodons - -o - $tabular_output - $inputfile - $fasta_output -]]> + <command> + <![CDATA[ +python '$__tool_directory__/tRNAscan.py' +#if $organism + $organism +#end if +#if $mode + $mode +#end if +#if $showPrimSecondOpt + $showPrimSecondOpt +#end if +#if $disablePseudo + $disablePseudo +#end if +#if $showCodons + $showCodons +#end if +-o +'$tabular_output' +'$inputfile' +'$fasta_output' + ]]> </command> <inputs> <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/> <param name="organism" type="select" label="Select Organism"> - <option value="">Eukaryotic</option> + <option value="" selected="true">Eukaryotic</option> <option value="-G">general tRNA model</option> <option value="-B">Bacterial</option> <option value="-A">Archaeal</option> <option value="-O">Mitochondrial/Chloroplast</option> </param> <param name="mode" type="select" label="Select Mode"> - <option value="">Default</option> + <option value="" selected="true">Default</option> <option value="-C">Covariance model analysis only (slow)</option> <option value="-T">tRNAscan only</option> <option value="-E">EufindtRNA only</option> - <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> + <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> <option value="--newscan">Infernal and new cm models</option> </param> <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" /> @@ -45,37 +57,34 @@ </outputs> <tests> <test> - <param name="input" value="trna_arabidopsis.fasta" ftype="fasta" /> + <param name="inputfile" value="trna_arabidopsis.fasta" ftype="fasta" /> <param name="organism" value="" /> - <param name="mode" value="--infernal" /> + <param name="mode" value="--infernal" /> <!-- Infernal test not working due to cmsearch error--> <param name="disablePseudo" value="" /> <param name="showPrimSecondOpt" value="" /> <param name="showCodons" value="" /> <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.fasta" ftype="fasta" /> - <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" /> + <output name="tabular_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" /> </test> </tests> <help> <![CDATA[ -.. class:: warningmark - -**TIP** This tool requires *fasta* formated sequences. - ------ - **What it does** - tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic - sequence feasible using the selectivity of the Cove analysis package. - We have optimized search sensitivity with eukaryote cytoplasmic and - eubacterial sequences, but it may be applied more broadly with a - slight reduction in sensitivity. +tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic +sequence feasible using the selectivity of the Cove analysis package. +We have optimized search sensitivity with eukaryote cytoplasmic and +eubacterial sequences, but it may be applied more broadly with a +slight reduction in sensitivity. .. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/ ------ +**Input** + +Nucleotide sequence in FASTA format. + **Organism** @@ -85,71 +94,71 @@ - use general tRNA model: - This option selects the general tRNA covariance model that was trained - on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and - Eukarya). This mode can be used when analyzing a mixed collection of - sequences from more than one phylogenetic domain, with only slight - loss of sensitivity and selectivity. The original publication - describing this program and tRNAscan-SE version 1.0 used this general - tRNA model exclusively. If you wish to compare scores to those found - in the paper or scans using v1.0, use this option. Use of this option - is compatible with all other search mode options described in this - section. + This option selects the general tRNA covariance model that was trained + on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and + Eukarya). This mode can be used when analyzing a mixed collection of + sequences from more than one phylogenetic domain, with only slight + loss of sensitivity and selectivity. The original publication + describing this program and tRNAscan-SE version 1.0 used this general + tRNA model exclusively. If you wish to compare scores to those found + in the paper or scans using v1.0, use this option. Use of this option + is compatible with all other search mode options described in this + section. - search for bacterial tRNAs - This option selects the bacterial covariance model for tRNA analysis, - and loosens the search parameters for EufindtRNA to improve detection - of bacterial tRNAs. Use of this mode with bacterial sequences - will also improve bounds prediction of the 3' end (the terminal CAA - triplet). + This option selects the bacterial covariance model for tRNA analysis, + and loosens the search parameters for EufindtRNA to improve detection + of bacterial tRNAs. Use of this mode with bacterial sequences + will also improve bounds prediction of the 3' end (the terminal CAA + triplet). - search for archaeal tRNAs - This option selects an archaeal-specific covariance model for tRNA - analysis, as well as slightly loosening the EufindtRNA search - cutoffs. + This option selects an archaeal-specific covariance model for tRNA + analysis, as well as slightly loosening the EufindtRNA search + cutoffs. - search for organellar (mitochondrial/chloroplast) tRNAs - This parameter bypasses the fast first-pass scanners that are poor at - detecting organellar tRNAs and runs Cove analysis only. Since true - organellar tRNAs have been found to have Cove scores between 15 and 20 - bits, the search cutoff is lowered from 20 to 15 bits. Also, - pseudogene checking is disabled since it is only applicable to - eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is - used, searches will be very slow (see -C option below) relative to the - default mode. + This parameter bypasses the fast first-pass scanners that are poor at + detecting organellar tRNAs and runs Cove analysis only. Since true + organellar tRNAs have been found to have Cove scores between 15 and 20 + bits, the search cutoff is lowered from 20 to 15 bits. Also, + pseudogene checking is disabled since it is only applicable to + eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is + used, searches will be very slow (see -C option below) relative to the + default mode. ------- + **Mode** - search using Cove analysis only (max sensitivity, slow) - Directs tRNAscan-SE to analyze sequences using Cove analysis only. - This option allows a slightly more sensitive search than the default - tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250 - to 3,000 fold). Output format and other program defaults are - otherwise identical to the normal analysis. + Directs tRNAscan-SE to analyze sequences using Cove analysis only. + This option allows a slightly more sensitive search than the default + tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250 + to 3,000 fold). Output format and other program defaults are + otherwise identical to the normal analysis. - search using Eukaryotic tRNA finder (EufindtRNA) only: - This option runs EufindtRNA alone to search for tRNAs. Since Cove is - not being used as a secondary filter to remove false positives, this - run mode defaults to "Normal" parameters which more closely - approximates the sensitivity and selectivity of the original algorithm - describe by Pavesi and colleagues. + This option runs EufindtRNA alone to search for tRNAs. Since Cove is + not being used as a secondary filter to remove false positives, this + run mode defaults to "Normal" parameters which more closely + approximates the sensitivity and selectivity of the original algorithm + describe by Pavesi and colleagues. - search using tRNAscan only (defaults to strict search parameters) - Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This - mode will cause tRNAscan to default to using "strict" parameters - (similar to tRNAscan version 1.3 operation). This mode of operation - is faster (about 3-5 times faster than default mode analysis), but - will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp, - decreased sensitivity, and less reliable prediction of anticodons, - tRNA isotype, and introns. + Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This + mode will cause tRNAscan to default to using "strict" parameters + (similar to tRNAscan version 1.3 operation). This mode of operation + is faster (about 3-5 times faster than default mode analysis), but + will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp, + decreased sensitivity, and less reliable prediction of anticodons, + tRNA isotype, and introns. - search using Infernal cm analysis only (max sensitivity, very slow) @@ -157,56 +166,54 @@ - search using Infernal and new cm models instead of Cove ------ **disable pseudogene checking** - Manually disable checking tRNAs for poor primary or secondary - structure scores often indicative of eukaryotic pseudogenes. This - will slightly speed the program and may be necessary for non-eukaryotic - sequences that are flagged as possible pseudogenes but are known to be - functional tRNAs. + Manually disable checking tRNAs for poor primary or secondary + structure scores often indicative of eukaryotic pseudogenes. This + will slightly speed the program and may be necessary for non-eukaryotic + sequences that are flagged as possible pseudogenes but are known to be + functional tRNAs. ------ **Show both primary and secondary structure score components to covariance model bit scores** - This option displays the breakdown of the two components of the - covariance model bit score. Since tRNA pseudogenes often have one - very low component (good secondary structure but poor primary sequence - similarity to the tRNA model, or vice versa), this information may be - useful in deciding whether a low-scoring tRNA is likely to be a - pseudogene. The heuristic pseudogene detection filter uses this - information to flag possible pseudogenes -- use this option to see why - a hit is marked as a possible pseudogene. The user may wish to - examine score breakdowns from known tRNAs in the organism of interest - to get a frame of reference. + This option displays the breakdown of the two components of the + covariance model bit score. Since tRNA pseudogenes often have one + very low component (good secondary structure but poor primary sequence + similarity to the tRNA model, or vice versa), this information may be + useful in deciding whether a low-scoring tRNA is likely to be a + pseudogene. The heuristic pseudogene detection filter uses this + information to flag possible pseudogenes -- use this option to see why + a hit is marked as a possible pseudogene. The user may wish to + examine score breakdowns from known tRNAs in the organism of interest + to get a frame of reference. ------ + **Show codons instead of tRNA anticodons** - This option causes tRNAscan-SE to output a tRNA's corresponding codon - in place of its anticodon. + This option causes tRNAscan-SE to output a tRNA's corresponding codon + in place of its anticodon. ------ + **Example** -* input: +**input** - >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 - GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT - GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT - TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT - TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC - GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA - ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG - AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA - ..... + >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7 + GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT + GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT + TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT + TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC + GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA + ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG + AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA + ..... -* output: +**output** ======== ====== ===== ====== ==== ========== ====== ====== ========== ========== @@ -222,17 +229,9 @@ ======== ====== ===== ====== ==== ========== ====== ====== ========== ========== -------- - -**References** - -Todd M. Lowe and Sean R. Eddy - -tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964 - -doi:10.1093/nar/25.5.0955 - - ]]> </help> + <citations> + <citation type="doi">10.1093/nar/25.5.0955</citation> + </citations> </tool>