# HG changeset patch
# User bgruening
# Date 1373121433 14400
# Node ID d34f31cbc9ddba7c9bdbe9253ec644a4c62bd9e5
Uploaded
diff -r 000000000000 -r d34f31cbc9dd aragorn.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/aragorn.xml Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,180 @@
+
+ prediction (Aragon)
+
+ aragorn
+
+
+ aragorn
+ $input
+ -gc$genbank_gencode
+ $tmRNA
+ $tRNA
+ $mtRNA
+ $mam_mtRNA
+ $topology
+ -o $output
+ $secondary_structure
+ $introns
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+Aragorn_ predicts tRNA (and tmRNA) in nucleotide sequences.
+
+.. _Aragorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/
+
+-----
+
+**Example**
+
+Suppose you have the following nucleotide sequences::
+
+ >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
+ cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+ ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+ cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+ cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+ ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+ ....
+
+Running this tool can produce a FASTA file with all detected RNAs or a more detailed text file like the following::
+
+ c
+ c
+ a
+ g-c
+ g-c
+ g-c
+ c-g
+ g-c
+ a-t
+ t-a ca
+ t tgacc a
+ ga a !!!!! g
+ t ctcg actgg c
+ g !!!! c tt
+ g gagc t
+ aa g g
+ c-gag
+ t-a
+ t-a
+ c-g
+ g-c
+ t c
+ t a
+ cac
+
+ tRNA-Val(cac)
+ 74 bases, %GC = 58.1
+ Sequence [6669703,6669776]
+
+
+ tRNA Anticodon Frequency
+ AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
+ AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
+ ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
+ ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
+ AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
+ AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
+ ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
+ ATG His GTG His 2 CTG Gln 2 TTG Gln 1
+ AAC Val GAC Val 3 CAC Val 2 TAC Val 1
+ AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
+ ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
+ ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
+ AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
+ AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
+ ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
+ ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
+ Ambiguous: 1
+
+ tRNA Codon Frequency
+ TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
+ TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
+ TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
+ TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
+ CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
+ CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
+ CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
+ CAT His CAC His 2 CAG Gln 2 CAA Gln 1
+ GTT Val GTC Val 3 GTG Val 2 GTA Val 1
+ GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
+ GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
+ GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
+ ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
+ ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
+ AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
+ AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
+ Ambiguous: 1
+
+ Number of tRNA genes = 86
+ tRNA GC range = 50.0% to 85.1%
+ Number of tmRNA genes = 1
+
+-------
+
+**References**
+
+Dean Laslett and Bjorn Canback
+
+ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
+
+doi:10.1093/nar/gkh152
+
+
+
diff -r 000000000000 -r d34f31cbc9dd readme.rst
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,93 @@
+Galaxy wrapper for t-RNA prediction tools
+=========================================
+
+This wrapper is copyright 2012-2013 by Björn Grüning.
+
+This prepository contains wrapper for the command line tools of tRNAscan-SE_ and Arogorn_.
+
+.. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/
+.. _Arogorn: http://mbio-serv2.mbioekol.lu.se/ARAGORN/
+
+Dean Laslett and Bjorn Canback
+ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
+doi:10.1093/nar/gkh152
+
+Todd M. Lowe and Sean R. Eddy
+tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
+doi:10.1093/nar/25.5.0955
+
+
+============
+Installation
+============
+
+The t-RNA prediction wrappers are available through the toolshed_ and can be automatically installed.
+
+.. _toolshed: http://toolshed.g2.bx.psu.edu/view/bjoern-gruening/trna_prediction
+
+For manuel installation, please download tRNAscan-SE from the following URL and follow the install instructions::
+
+ http://lowelab.ucsc.edu/software/tRNAscan-SE.tar.gz
+
+Arogorn can be download from::
+
+ http://mbio-serv2.mbioekol.lu.se/ARAGORN/aragorn1.2.33.c
+
+With a recent GNU-Compiler (gcc) you can compile it with the following command::
+
+ gcc -O3 -ffast-math -finline-functions -o aragorn aragorn1.2.33.c
+
+Please include aragorn and tRNAscan-SE into your PATH::
+
+ export PATH=$PATH:/home/user/bin/aragorn/bin/
+
+
+To install the wrappers copy the files aragorn.xml and tRNAscan.xml in the galaxy tools
+folder and modify the tools_conf.xml file to make the tool available to Galaxy.
+For example add the following lines::
+
+
+
+
+
+=======
+History
+=======
+
+tRNAscan:
+
+ - v0.1: Initial public release
+ - v0.2: add fasta output
+ - v0.2.1: added tool-dependency
+ - v0.2.2: patch from Nicola Soranzo added
+ - v0.3: add unit tests, documentation improvements, bug fixes
+
+aragorn:
+
+ - v0.1: Initial public release
+ - v0.2: added options, upgrade to 1.2.36, tool-dependency
+ - v0.3: add unit tests, documentation improvements
+
+
+
+Wrapper Licence (MIT/BSD style)
+===============================
+
+Permission to use, copy, modify, and distribute this software and its
+documentation with or without modifications and for any purpose and
+without fee is hereby granted, provided that any copyright notices
+appear in all copies and that both those copyright notices and this
+permission notice appear in supporting documentation, and that the
+names of the contributors or copyright holders not be used in
+advertising or publicity pertaining to distribution of the software
+without specific prior permission.
+
+THE CONTRIBUTORS AND COPYRIGHT HOLDERS OF THIS SOFTWARE DISCLAIM ALL
+WARRANTIES WITH REGARD TO THIS SOFTWARE, INCLUDING ALL IMPLIED
+WARRANTIES OF MERCHANTABILITY AND FITNESS, IN NO EVENT SHALL THE
+CONTRIBUTORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY SPECIAL, INDIRECT
+OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS
+OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE
+OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE
+OR PERFORMANCE OF THIS SOFTWARE.
+
diff -r 000000000000 -r d34f31cbc9dd tRNAscan.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.py Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,71 @@
+#!/usr/bin/env python
+
+"""
+ Converts tRNAScan output back to fasta-sequences.
+"""
+import sys
+from Bio import SeqIO
+from Bio.SeqRecord import SeqRecord
+import subprocess
+
+
+def main(args):
+ """
+ Call from galaxy:
+ tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons $tabular_output $inputfile $fasta_output
+
+ tRNAscan-SE $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -d -Q -y -q -b -o $tabular_output $inputfile;
+ """
+ cmd = """tRNAscan-SE -Q -y -q -b %s""" % ' '.join( args[:-1] )
+ child = subprocess.Popen(cmd.split(),
+ stdout=subprocess.PIPE, stderr=subprocess.PIPE)
+ stdout, stderr = child.communicate()
+ return_code = child.returncode
+ if return_code:
+ sys.stdout.write(stdout)
+ sys.stderr.write(stderr)
+ sys.stderr.write("Return error code %i from command:\n" % return_code)
+ sys.stderr.write("%s\n" % cmd)
+ else:
+ sys.stdout.write(stdout)
+ sys.stdout.write(stderr)
+
+ outfile = args[-1]
+ sequence_file = args[-2]
+ tRNAScan_file = args[-3]
+
+ with open( sequence_file ) as sequences:
+ sequence_recs = SeqIO.to_dict(SeqIO.parse(sequences, "fasta"))
+
+ tRNAs = []
+ with open(tRNAScan_file) as tRNA_handle:
+ for line in tRNA_handle:
+ line = line.strip()
+ if not line or line.startswith('#'):
+ continue
+ cols = line.split()
+ iid = cols[0].strip()
+ start = int(cols[2])
+ end = int(cols[3])
+ aa = cols[4]
+ codon = cols[5]
+ rec = sequence_recs[ iid ]
+ if start > end:
+ new_rec = rec[end:start]
+ new_rec.seq = new_rec.seq.reverse_complement()
+ new_rec.description = "%s %s %s %s %s" % (rec.description, aa, codon, start, end)
+ new_rec.id = rec.id
+ new_rec.name = rec.name
+ tRNAs.append( new_rec )
+ else:
+ new_rec = rec[start:end]
+ new_rec.id = rec.id
+ new_rec.name = rec.name
+ new_rec.description = "%s %s %s %s %s" % (rec.description, aa, codon, start, end)
+ tRNAs.append( new_rec )
+
+ SeqIO.write(tRNAs, open(outfile, 'w+'), "fasta")
+
+
+if __name__ == '__main__':
+ main(sys.argv[1:])
diff -r 000000000000 -r d34f31cbc9dd tRNAscan.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tRNAscan.xml Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,234 @@
+
+ (tRNAscan)
+
+ tRNAscan-SE
+ biopython
+
+
+ tRNAscan.py
+ $organism
+ $mode
+ $showPrimSecondOpt
+ $disablePseudo
+ $showCodons
+ -o
+ $tabular_output
+ $inputfile
+ $fasta_output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+**TIP** This tool requires *fasta* formated sequences.
+
+-----
+
+**What it does**
+
+ tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic
+ sequence feasible using the selectivity of the Cove analysis package.
+ We have optimized search sensitivity with eukaryote cytoplasmic and
+ eubacterial sequences, but it may be applied more broadly with a
+ slight reduction in sensitivity.
+
+.. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/
+
+-----
+
+**Organism**
+
+- search for eukaryotic cytoplasmic tRNAs:
+
+ This is the default.
+
+- use general tRNA model:
+
+ This option selects the general tRNA covariance model that was trained
+ on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
+ Eukarya). This mode can be used when analyzing a mixed collection of
+ sequences from more than one phylogenetic domain, with only slight
+ loss of sensitivity and selectivity. The original publication
+ describing this program and tRNAscan-SE version 1.0 used this general
+ tRNA model exclusively. If you wish to compare scores to those found
+ in the paper or scans using v1.0, use this option. Use of this option
+ is compatible with all other search mode options described in this
+ section.
+
+- search for bacterial tRNAs
+
+ This option selects the bacterial covariance model for tRNA analysis,
+ and loosens the search parameters for EufindtRNA to improve detection
+ of bacterial tRNAs. Use of this mode with bacterial sequences
+ will also improve bounds prediction of the 3' end (the terminal CAA
+ triplet).
+
+- search for archaeal tRNAs
+
+ This option selects an archaeal-specific covariance model for tRNA
+ analysis, as well as slightly loosening the EufindtRNA search
+ cutoffs.
+
+- search for organellar (mitochondrial/chloroplast) tRNAs
+
+ This parameter bypasses the fast first-pass scanners that are poor at
+ detecting organellar tRNAs and runs Cove analysis only. Since true
+ organellar tRNAs have been found to have Cove scores between 15 and 20
+ bits, the search cutoff is lowered from 20 to 15 bits. Also,
+ pseudogene checking is disabled since it is only applicable to
+ eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
+ used, searches will be very slow (see -C option below) relative to the
+ default mode.
+
+------
+
+**Mode**
+
+- search using Cove analysis only (max sensitivity, slow)
+
+ Directs tRNAscan-SE to analyze sequences using Cove analysis only.
+ This option allows a slightly more sensitive search than the default
+ tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
+ to 3,000 fold). Output format and other program defaults are
+ otherwise identical to the normal analysis.
+
+- search using Eukaryotic tRNA finder (EufindtRNA) only:
+
+ This option runs EufindtRNA alone to search for tRNAs. Since Cove is
+ not being used as a secondary filter to remove false positives, this
+ run mode defaults to "Normal" parameters which more closely
+ approximates the sensitivity and selectivity of the original algorithm
+ describe by Pavesi and colleagues.
+
+- search using tRNAscan only (defaults to strict search parameters)
+
+ Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
+ mode will cause tRNAscan to default to using "strict" parameters
+ (similar to tRNAscan version 1.3 operation). This mode of operation
+ is faster (about 3-5 times faster than default mode analysis), but
+ will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
+ decreased sensitivity, and less reliable prediction of anticodons,
+ tRNA isotype, and introns.
+
+- search using Infernal cm analysis only (max sensitivity, very slow)
+
+
+- search using Infernal and new cm models instead of Cove
+
+
+-----
+
+**disable pseudogene checking**
+
+ Manually disable checking tRNAs for poor primary or secondary
+ structure scores often indicative of eukaryotic pseudogenes. This
+ will slightly speed the program and may be necessary for non-eukaryotic
+ sequences that are flagged as possible pseudogenes but are known to be
+ functional tRNAs.
+
+-----
+
+**Show both primary and secondary structure score components to covariance model bit scores**
+
+ This option displays the breakdown of the two components of the
+ covariance model bit score. Since tRNA pseudogenes often have one
+ very low component (good secondary structure but poor primary sequence
+ similarity to the tRNA model, or vice versa), this information may be
+ useful in deciding whether a low-scoring tRNA is likely to be a
+ pseudogene. The heuristic pseudogene detection filter uses this
+ information to flag possible pseudogenes -- use this option to see why
+ a hit is marked as a possible pseudogene. The user may wish to
+ examine score breakdowns from known tRNAs in the organism of interest
+ to get a frame of reference.
+
+-----
+
+**Show codons instead of tRNA anticodons**
+
+ This option causes tRNAscan-SE to output a tRNA's corresponding codon
+ in place of its anticodon.
+
+-----
+
+**Example**
+
+* input:
+
+ >CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+ GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+ GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+ TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+ TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+ GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+ ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+ AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+ .....
+
+
+* output:
+
+
+ ======== ====== ===== ====== ==== ========== ====== ====== ========== ==========
+ tRNA Bounds Intron Bonds
+ -------- ------ ---------------- ---- ---------- ---------------- ---------- ----------
+ Name # tRNA Begin End tRNA Anti Codon Begin End Cove Score Hit Origin
+ ======== ====== ===== ====== ==== ========== ====== ====== ========== ==========
+ CELF22B7 1 12619 12738 Leu CAA 12657 12692 55.12 Bo
+ CELF22B7 2 19480 19561 Ser AGA 0 0 66.90 Bo
+ CELF22B7 3 26367 26439 Phe GAA 0 0 73.88 Bo
+ CELF22B7 4 26992 26920 Phe GAA 0 0 73.88 Bo
+ CELF22B7 5 23765 23694 Pro CGG 0 0 60.58 Bo
+ ======== ====== ===== ====== ==== ========== ====== ====== ========== ==========
+
+
+-------
+
+**References**
+
+Todd M. Lowe and Sean R. Eddy
+
+tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
+
+doi:10.1093/nar/25.5.0955
+
+
+
+
diff -r 000000000000 -r d34f31cbc9dd test-data/aragorn_tansl-table-1_tmRNA_tRNA.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/aragorn_tansl-table-1_tmRNA_tRNA.fasta Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,3 @@
+>1-1 tRNA-Ala(tgc) [381,453]
+ggggatgtagctcatatggtagagcgctcgctttgcatgcgagaggcaca
+gggttcgattccctgcatctcca
diff -r 000000000000 -r d34f31cbc9dd test-data/tRNAscan_eukaryotic_infernal.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNAscan_eukaryotic_infernal.fasta Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,3 @@
+>gi|240255695:23036500-23037000 Arabidopsis thaliana chromosome 3, complete sequence Ala TGC 381 453
+GGGATGTAGCTCATATGGTAGAGCGCTCGCTTTGCATGCGAGAGGCACAGGGTTCGATTC
+CCTGCATCTCCA
diff -r 000000000000 -r d34f31cbc9dd test-data/tRNAscan_eukaryotic_infernal.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/tRNAscan_eukaryotic_infernal.tabular Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,1 @@
+gi|240255695:23036500-23037000 1 381 453 Ala TGC 0 0 67.36
diff -r 000000000000 -r d34f31cbc9dd test-data/trna_arabidopsis.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trna_arabidopsis.fasta Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,10 @@
+>gi|240255695:23036500-23037000 Arabidopsis thaliana chromosome 3, complete sequence
+CGATAGGAGACTCGGTCTTGCAGATACAGCAGCGAGGATCGTCGAGGACGAATCGGAGACGAACGACGCA
+TGTGGAGCAAACCTCTCGGTGACCACAAGATCCATAGGCAACCCATTCGAGATTGTCAGCGCAGACGGCA
+CAGCTATCATCCATGTCTCTTCCTGAATTTGAGATCGAGATAAGGAAATTGTTTCGAAACGACAACAATA
+GAGATTGATGAGCAAGAGAGATCTAGGGTTCTCGAAAGAGGGCTCGCTAAATAAAAGGGCTAGATGAAGA
+AGAATATCAAAGGTCTCCTAATCATCAAGGCCAGTCAAACAAATACATAAATAAATTAATCGTTGATACT
+ATTTAGTTAAAAAAGTGTTGAGAATCATTCGGGGATGTAGCTCATATGGTAGAGCGCTCGCTTTGCATGC
+GAGAGGCACAGGGTTCGATTCCCTGCATCTCCATTTTTATTTTCTTTTTTTTATAACTTTTGGTGAGCTT
+AATGGCCCAAT
+
diff -r 000000000000 -r d34f31cbc9dd tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Sat Jul 06 10:37:13 2013 -0400
@@ -0,0 +1,47 @@
+
+
+
+
+
+
+
+
+ http://mbio-serv2.mbioekol.lu.se/ARAGORN/Downloads/aragorn1.2.36.tgz
+ $INSTALL_DIR/bin/
+ gcc -O3 -ffast-math -finline-functions -o aragorn aragorn1.2.36.c
+
+ aragorn
+ $INSTALL_DIR/bin
+
+
+ $INSTALL_DIR/bin
+
+
+
+ Compiling ARAGORN requires gcc.
+
+
+
+
+ http://lowelab.ucsc.edu/software/tRNAscan-SE.tar.gz
+ $INSTALL_DIR/bin/
+ $INSTALL_DIR/lib/tRNAscan-SE/
+ $INSTALL_DIR/man/
+
+ cd ./tRNAscan-SE-1.3.1 && sed 's%^BINDIR = .*%BINDIR = $INSTALL_DIR/bin/%' Makefile | sed 's%^LIBDIR = .*%LIBDIR = $INSTALL_DIR/lib/tRNAscan-SE/%' | sed 's%^MANDIR = .*%MANDIR = $INSTALL_DIR/man%' > Makefile_new
+ cd ./tRNAscan-SE-1.3.1 && rm Makefile && mv Makefile_new Makefile
+ cd ./tRNAscan-SE-1.3.1 && make && make install
+
+
+ wget ftp://selab.janelia.org/pub/software/infernal/infernal-1.0.2.tar.gz
+ tar xfvz infernal-1.0.2.tar.gz
+ cd infernal-1.0.2 && ./configure --prefix=$INSTALL_DIR && make && make install
+
+ $INSTALL_DIR/bin
+ $INSTALL_DIR/bin/
+
+
+
+ Compiling and running tRNAScan-SE requires gcc a PERL environment.
+
+