|
0
|
1 <tool id="plant_sirna_pipeline_v1" name="siRNA_pipeline" veision="1.0.0">
|
|
|
2 <description>Program for plant siRNA analysis (rawdata preprocess -> genome alignment -> non-coding annotate -> siRNA analysis)</description>
|
|
|
3
|
|
|
4 <requirements>
|
|
|
5 <requirement type="set_environment">SCRIPT_PATH</requirement>
|
|
|
6 <requirement type="package" version="0.12.7">bowtie</requirement>
|
|
|
7 <requirement type="package" version="3.0.1">R</requirement>
|
|
|
8 <requirement type="package" version="0.0.13">fastx_toolkit </requirement>
|
|
|
9 <requirement type="package" version="1.96">threads</requirement>
|
|
|
10 <requirement type="package" version="1.06">Parallel-ForkManager</requirement>
|
|
|
11 <requirement type="package" version="2.59">SVG</requirement>
|
|
|
12 <requirement type="package" version="1.4_001">Boost-Graph</requirement>
|
|
|
13 </requirements>
|
|
|
14
|
|
|
15 <command interpreter="perl">siRNA_pipeline.pl
|
|
|
16 ## Change this to accommodate the number of threads you have available.
|
|
|
17 -t \${GALAXY_SLOTS:-4}
|
|
|
18
|
|
|
19 -path \$SCRIPT_PATH
|
|
|
20
|
|
|
21 #for $j, $s in enumerate( $series )
|
|
|
22 ##rank_of_series=$j
|
|
|
23 -i ${s.input}
|
|
|
24 -tag ${s.tag}
|
|
|
25 #end for
|
|
|
26
|
|
|
27 ## prepare bowtie index
|
|
|
28 #set index_path = ''
|
|
|
29 #if str($reference_genome.source) == "history":
|
|
|
30 #set index_path = $reference_genome.own_file
|
|
|
31 -g $index_path
|
|
|
32 #else:
|
|
|
33 #set index_path = $reference_genome.index.fields.path
|
|
|
34 -g ${index_path}.fa -idx $index_path
|
|
|
35 #end if
|
|
|
36
|
|
|
37
|
|
|
38 ## prepare Rfam bowtie index
|
|
|
39 #set rfam_index_path = ''
|
|
|
40 #if str($reference_rfam.source) == "history":
|
|
|
41 #set rfam_index_path = $reference_rfam.own_file
|
|
|
42 -rfam $rfam_index_path -v $v
|
|
|
43 #else:
|
|
|
44 #set rfam_index_path = $reference_rfam.index.fields.path
|
|
|
45 -rfam ${rfam_index_path}.fa -idx2 $rfam_index_path -v $v
|
|
|
46 #end if
|
|
|
47
|
|
|
48
|
|
|
49
|
|
|
50 ## Do or not annotate siRNAs by function
|
|
|
51 #if $params.function_anno == "yes":
|
|
|
52
|
|
|
53 ## prepare bowtie index
|
|
|
54 #set nat_path = ''
|
|
|
55 #if str($params.nat_file.source) == "history":
|
|
|
56 #set nat_path = $params.nat_file.nat
|
|
|
57
|
|
|
58 #else:
|
|
|
59 #set nat_path = $params.nat_file.index.fields.path
|
|
|
60 #end if
|
|
|
61
|
|
|
62 ## prepare bowtie index
|
|
|
63 #set repeat_path = ''
|
|
|
64 #if str($params.repeat_file.source) == "history":
|
|
|
65 #set repeat_path = $params.repeat_file.repeat
|
|
|
66
|
|
|
67 #else:
|
|
|
68 #set repeat_path = $params.repeat_file.index.fields.path
|
|
|
69 #end if
|
|
|
70
|
|
|
71
|
|
|
72 -nat $nat_path -repeat $repeat_path
|
|
|
73 #end if
|
|
|
74
|
|
|
75 ## Do or not DEG
|
|
|
76 #if $degseq.degseq_analysis == "yes" :
|
|
|
77 -deg $degseq.deg
|
|
|
78 #end if
|
|
|
79
|
|
|
80 -format $format -phred $phred -f $gff -mis $mis -a $a -n $mapnt -d $d -p $p -l $l -cen $cen -span $span > run.log
|
|
|
81
|
|
|
82 </command>
|
|
|
83
|
|
|
84 <inputs>
|
|
|
85
|
|
|
86 <repeat name="series" title="Raw sequence data file">
|
|
|
87 <param name="input" type="data" label="Raw data file"/>
|
|
|
88 <param name="tag" type="text" data_ref="input" label="Sample name of raw data"/>
|
|
|
89 </repeat>
|
|
|
90
|
|
|
91 <param name="format" type="select" label="raw data format" multiple="false">
|
|
|
92 <option value="fastq">Raw data is fastq. format</option>
|
|
|
93 <option value="fasta">Raw data is fasta. format</option>
|
|
|
94 </param>
|
|
|
95
|
|
|
96 <param name="phred" type="select" label="input quals are Phred+64 or Phred+33" multiple="false">
|
|
|
97 <option value="64">Phred+64</option>
|
|
|
98 <option value="33" selected="true">Phred+33</option>
|
|
|
99 </param>
|
|
|
100
|
|
|
101 <conditional name="reference_genome">
|
|
|
102 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
|
|
|
103 <option value="indexed">Use a built-in index</option>
|
|
|
104 <option value="history">Use one from the history</option>
|
|
|
105 </param>
|
|
|
106 <when value="indexed">
|
|
|
107 <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
|
|
|
108 <options from_data_table="bowtie_indexes">
|
|
|
109 <filter type="sort_by" column="2"/>
|
|
|
110 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
111 </options>
|
|
|
112 </param>
|
|
|
113 </when>
|
|
|
114 <when value="history">
|
|
|
115 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
|
116 </when>
|
|
|
117 </conditional> <!--param type="data" name="index" label="genome sequence bowtie index"/-->
|
|
|
118
|
|
|
119 <conditional name="reference_rfam">
|
|
|
120 <param name="source" type="select" label="Will you select a rfam reference from your history or use a built-in index?" help="Built-ins were indexed using default options">
|
|
|
121 <option value="indexed">Use a built-in index</option>
|
|
|
122 <option value="history">Use one from the history</option>
|
|
|
123 </param>
|
|
|
124 <when value="indexed">
|
|
|
125 <param name="index" type="select" label="Select a non-coding reference " help="If your rfam of interest is not listed, contact the Galaxy team">
|
|
|
126 <options from_data_table="rfam_bowtie_indexes">
|
|
|
127 <filter type="sort_by" column="2"/>
|
|
|
128 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
|
129 </options>
|
|
|
130 </param>
|
|
|
131 </when>
|
|
|
132 <when value="history">
|
|
|
133 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference" />
|
|
|
134 </when>
|
|
|
135 </conditional>
|
|
|
136
|
|
|
137 <param name="gff" type="data" label="gff file" />
|
|
|
138 <param name="mis" type="integer" value="0" label="number of allowed mismatches when mapping reads to genome" />
|
|
|
139 <param name="v" type="integer" value="0" label="report end-to-end hits less than v mismatches for non-coding alignment"/>
|
|
|
140 <param name="a" type="text" value="TGGAATTCTCGGGTGCCAAGG" label="3' adapter sequence" />
|
|
|
141 <param name="mapnt" type="integer" value="25" label="a read is allowed to map up to this number of positions in the genome" />
|
|
|
142 <param name="d" type="integer" value="100" label="distance of tag to merged a cluster" />
|
|
|
143
|
|
|
144 <param name="p" type="select" label="siRNA cluster identify method" multiple="false">
|
|
|
145 <option value="F">conventional</option>
|
|
|
146 <option value="T">NIBLES</option>
|
|
|
147 </param>
|
|
|
148 <param name="l" type="integer" value="1000" label="the length of the upstream and downstream,used in position annotate" />
|
|
|
149
|
|
|
150
|
|
|
151 <conditional name="params">
|
|
|
152 <param name="function_anno" type="select" label="Do or not annotate siRNAs by function">
|
|
|
153 <option value="no" selected="true">no</option>
|
|
|
154 <option value="yes">yes</option>
|
|
|
155 </param>
|
|
|
156 <when value="yes">
|
|
|
157
|
|
|
158
|
|
|
159 <conditional name="nat_file">
|
|
|
160 <param name="source" type="select" label="Will you select a atural antisense transcripts file from your history ?" help="down load from ***">
|
|
|
161 <option value="indexed">Use a built-in file</option>
|
|
|
162 <option value="history">Use one from the history</option>
|
|
|
163 </param>
|
|
|
164 <when value="indexed">
|
|
|
165 <param name="index" type="select" label="Select a atural antisense transcripts file" help="If your species of interest is not listed, contact the Galaxy team">
|
|
|
166 <options from_data_table="nat_annotate">
|
|
|
167 <filter type="sort_by" column="2"/>
|
|
|
168 <validator type="no_options" message="No files are available for the selected input dataset"/>
|
|
|
169 </options>
|
|
|
170 </param>
|
|
|
171 </when>
|
|
|
172 <when value="history">
|
|
|
173 <param name="nat" type="data" format="txt" metadata_name="dbkey" label="atural antisense transcripts file" />
|
|
|
174 </when>
|
|
|
175 </conditional> <!--param type="data" name="index" label="genome sequence bowtie index"/-->
|
|
|
176
|
|
|
177 <conditional name="repeat_file">
|
|
|
178 <param name="source" type="select" label="Will you select a repeat information file from your history ?" help="down load from ***">
|
|
|
179 <option value="indexed">Use a built-in file</option>
|
|
|
180 <option value="history">Use one from the history</option>
|
|
|
181 </param>
|
|
|
182 <when value="indexed">
|
|
|
183 <param name="index" type="select" label="Select a repeat information file" help="If your species of interest is not listed, contact the Galaxy team">
|
|
|
184 <options from_data_table="repeat_annotate">
|
|
|
185 <filter type="sort_by" column="2"/>
|
|
|
186 <validator type="no_options" message="No files are available for the selected input dataset"/>
|
|
|
187 </options>
|
|
|
188 </param>
|
|
|
189 </when>
|
|
|
190 <when value="history">
|
|
|
191 <param name="repeat" type="data" metadata_name="dbkey" label="repeat information file out of Repeatmasker" />
|
|
|
192 </when>
|
|
|
193 </conditional> <!--param type="data" name="index" label="genome sequence bowtie index"/-->
|
|
|
194 </when>
|
|
|
195 </conditional> <!-- params -->
|
|
|
196
|
|
|
197 <param name="cen" type="data" label="centromere file input" />
|
|
|
198 <param name="span" type="integer" value="50000" label="plot span" />
|
|
|
199
|
|
|
200 <conditional name="degseq">
|
|
|
201 <param name="degseq_analysis" type="select" label="Do or not identify Difference Expression Clusters">
|
|
|
202 <option value="no" selected="true">no</option>
|
|
|
203 <option value="yes">yes</option>
|
|
|
204 </param>
|
|
|
205 <when value="yes">
|
|
|
206 <param name="deg" type="data" label="file config of de sample" />
|
|
|
207 </when>
|
|
|
208 </conditional>
|
|
|
209
|
|
|
210 </inputs>
|
|
|
211
|
|
|
212 <outputs>
|
|
|
213 <data format="txt" name="siRNA cluster" from_work_dir="cluster_runs/total.result" label="${tool.name} on ${on_string}: siRNA cluster"/>
|
|
|
214 <data format="html" name="analysis result" from_work_dir="cluster_runs/result.html" label="${tool.name} on ${on_string}: analysis result"/>
|
|
|
215
|
|
|
216 </outputs>
|
|
|
217
|
|
|
218 <help>
|
|
|
219
|
|
|
220 </help>
|
|
|
221 </tool>
|
