Mercurial > repos > bigrna > gpsrna

comparison preProcess.xml @ 0:87fe81de0931 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author bigrna
date Sun, 04 Jan 2015 02:47:25 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:87fe81de0931
1 <tool id="preprocess" name="preProcess" veision="1.0.0">
2 <description>Program for Raw data preprocess analysis, including 3' adapter triming, reads collaping, genome mapping and rfam non-miRNA analysis </description>
3
4 <requirements>
5 <requirement type="package" version="0.0.13">fastx_toolkit </requirement>
6 <requirement type="package" version="0.12.7">bowtie</requirement>
7 <requirement type="set_environment">SCRIPT_PATH</requirement>
8 <!--requirement type="package" version="3.0.1">R</requirement!-->
9 <requirement type="package" version="1.96">threads</requirement>
10 <requirement type="package" version="2.59">SVG</requirement>
11 <requirement type="package" version="2.1.8">ViennaRNA</requirement>
12 </requirements>
13
14 <!--command interpreter="perl">miPlant.pl -i $input -format $format -gfa $gfa -idx $index -pre $pre -mat $mat -rfam $rfam -idx2 $idx2 -D $D -a $a -M $M -min $min -max $max -mis $mis -e $e -f $f -v $v -r $r -dis $dis -flank $flank -mfe $mfe -t $t -o $output</command-->
15
16 <command interpreter="perl">preProcess.pl
17 ## Change this to accommodate the number of threads you have available.
18 -t \${GALAXY_SLOTS:-4}
19 -path \$SCRIPT_PATH
20
21 #for $j, $s in enumerate( $series )
22 ##rank_of_series=$j
23 -i ${s.input}
24 -tag ${s.tag}
25 #end for
26
27 ## Do or not annotate rfam non-miRNA RNAs
28 #if $nocoding.annotate_rfam == "yes":
29 ## prepare Rfam bowtie index
30 #set rfam_index_path = ''
31 #if str($nocoding.reference_rfam.source) == "history":
32 -rfam $nocoding.reference_rfam.own_file
33 #else:
34 #set rfam_index_path = $nocoding.reference_rfam.index.fields.path
35 -rfam ${rfam_index_path}.fa -idx2 $rfam_index_path
36 #end if
37 -v $nocoding.v
38 #end if
39
40 ## prepare bowtie index
41 #set index_path = ''
42 #if str($reference_genome.source) == "history":
43 #set index_path = 'genome'
44 -gfa $reference_genome.own_file
45 #else:
46 #set index_path = $reference_genome.index.fields.path
47 -gfa ${index_path}.fa -idx $index_path
48 #end if
49
50 -format $format -phred $phred -a $a -M $mapnt -min $min -max $max -mis $mismatch > run.log
51 </command>
52
53 <inputs>
54
55 <repeat name="series" title="Raw sequence data">
56 <param name="input" type="data" label="Raw data"/>
57 <param name="tag" type="text" data_ref="input" label="Sample name of raw data"/>
58 </repeat>
59
60 <!--param name="input" format="tabular" type="data" label="input config file" /-->
61
62 <param name="format" type="select" label="Raw data format" multiple="false">
63 <option value="fastq">Raw data is fastq. format</option>
64 <option value="fasta">Raw data is fasta. format</option>
65 </param>
66 <param name="phred" type="select" label="Input quals are Phred+64 or Phred+33" multiple="false">
67 <option value="64">Phred+64</option>
68 <option value="33" selected="true">Phred+33</option>
69 </param>
70
71 <!-- reference genome -->
72 <conditional name="reference_genome">
73 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
74 <option value="indexed">Use a built-in index</option>
75 <option value="history">Use one from the history</option>
76 </param>
77 <when value="indexed">
78 <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
79 <options from_data_table="bowtie_indexes">
80 <filter type="sort_by" column="2"/>
81 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
82 </options>
83 </param>
84 </when>
85 <when value="history">
86 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
87 </when>
88 </conditional>
89
90 <!--param name="gfa" type="data" label="genome sequence fasta file"/-->
91 <!--param type="data" name="index" label="genome sequence bowtie index"/-->
92 <param name="a" type="text" value="TGGAATTCTCGGGTGCCAAGG" label="3' adapter sequence" />
93 <param name="mapnt" type="integer" value="8" label="minimum adapter map nts" />
94 <param name="min" type="integer" value="19" label="Minimum microRNA length" />
95 <param name="max" type="integer" value="28" label="Maximum microRNA length" />
96 <param name="mismatch" type="integer" value="0" label="Number of allowed mismatches when mapping reads to genome" />
97
98 <conditional name="nocoding">
99 <param name="annotate_rfam" type="select" label="Annotate nocoding RNAs(excluding miRNA)">
100 <option value="yes" selected="true">yes</option>
101 <option value="no">no</option>
102 </param>
103 <when value="yes">
104 <!--param name="rfam" type="data" label="rfam sequence file" /-->
105 <conditional name="reference_rfam">
106 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
107 <option value="indexed">Use a built-in index</option>
108 <option value="history">Use one from the history</option>
109 </param>
110 <when value="indexed">
111 <param name="index" type="select" label="Select a reference" help="If your reference of interest is not listed, contact the Galaxy team">
112 <options from_data_table="rfam_bowtie_indexes">
113 <filter type="sort_by" column="2"/>
114 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
115 </options>
116 </param>
117 </when>
118 <when value="history">
119 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference" />
120 </when>
121 </conditional>
122
123 <param name="v" type="integer" value="0" label="Report end-to-end hits less than v mismatches for non-coding RNA annotation"/>
124 </when>
125 </conditional>
126
127
128
129 </inputs>
130
131 <outputs>
132 <data format="html" name="preprocess result" from_work_dir="preProcess/preprocessResult.html" label="${tool.name} on ${on_string}: preprocess result"/>
133
134 <data format="txt" name="clean FASTA data" from_work_dir="preProcess/preProcess_clean/clean_data.fa" label="${tool.name} on ${on_string}: clean FASTA data"/>
135
136 <data format="txt" name="genome mapping result" from_work_dir="preProcess/genome_match/genome_mapped.bwt" label="${tool.name} on ${on_string}: genome mapping result"/>
137 <data format="txt" name="genome mapped FASTA reads" from_work_dir="preProcess/genome_match/genome_mapped.fa" label="${tool.name} on ${on_string}: genome mapped FASTA reads"/>
138
139 <data format="txt" name="Rfam mapping result" from_work_dir="preProcess/rfam_match/rfam_mapped.bwt" label="${tool.name} on ${on_string}: Rfam mapping result">
140 <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
141 </data>
142 <data format="txt" name="Rfam mapped FASTA file" from_work_dir="preProcess/rfam_match/rfam_mapped.fa" label="${tool.name} on ${on_string}: Rfam mapped FASTA file">
143 <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
144 </data>
145 <data format="txt" name="Rfam not mapped FASTA file" from_work_dir="preProcess/rfam_match/rfam_not_mapped.fa" label="${tool.name} on ${on_string}: Rfam not mapped FASTA file">
146 <filter>(nocoding['annotate_rfam'] == 'yes')</filter>
147 </data>
148 <data format="txt" name="input config" from_work_dir="preProcess/input_config" label="${tool.name} on ${on_string}: input config"/>
149
150 </outputs>
151
152 <help>
153
154 </help>
155 </tool>