--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/augustus.xml	Thu Mar 15 10:09:28 2012 +0100
@@ -0,0 +1,186 @@
+<tool id="augustus" name="Augustus" version="0.1">
+	<description>gen prediction for eukaryotic genomes</description>
+    <command>augustus
+        --strand=$strand
+        $noInFrameStop
+        $gff
+        $protein
+        $introns
+        $start
+        $stop
+        $cds
+        $codingseq
+        $singlestrand
+        $input_genome 
+        --genemodel=$genemodel
+        --species=$organism
+        --outfile=$output
+
+        #please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config
+        #or use the --AUGUSTUS_CONFIG_PATH=path switch
+
+    </command>
+	<inputs>
+		<param name="input_genome" type="data" format="fasta" label="Genome Sequence"/>
+		<param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" />
+		<param name="gff" type="boolean" label="GFF formated output, standard is GTF" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" />
+		<param name="protein" type="boolean" label="Output predicted protein sequences" truevalue="--protein=on" falsevalue="--protein=off" checked="false" />
+		<param name="introns" type="boolean" label="Output predicted intron sequences" truevalue="--introns=on" falsevalue="--introns=off" checked="false" />
+		<param name="start" type="boolean" label="Output predicted start codons" truevalue="--start=on" falsevalue="--start=off" checked="false" />
+		<param name="stop" type="boolean" label="Output predicted stop codons" truevalue="--stop=on" falsevalue="--stop=off" checked="false" />
+		<param name="cds" type="boolean" label="Output CDS region" truevalue="--cds=on" falsevalue="--cds=off" checked="true" />
+		<param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="false" />
+
+		<param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" />
+
+        <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset.">
+            <option value="human">Homo sapiens</option>
+            <option value="fly">Drosophila melanogaster</option>
+            <option value="arabidopsis">Arabidopsis thaliana</option>
+            <option value="brugia ">Brugia malayi</option>
+            <option value="aedes">Aedes aegypti</option>
+            <option value="tribolium">Tribolium castaneum</option>
+            <option value="schistosoma">Schistosoma mansoni</option>
+            <option value="tetrahymena">Tetrahymena thermophila</option>
+            <option value="galdieria">Galdieria sulphuraria</option>
+            <option value="maize">Zea mays</option>
+            <option value="toxoplasma ">Toxoplasma gondii</option>
+            <option value="caenorhabditis ">Caenorhabditis elegans</option>
+            <option value="aspergillus_fumigatus">Aspergillus fumigatus</option>
+            <option value="aspergillus_nidulans ">Aspergillus nidulans</option>
+            <option value="aspergillus_oryzae ">Aspergillus oryzae</option>
+            <option value="aspergillus_terreus">Aspergillus terreus</option>
+            <option value="botrytis_cinerea ">Botrytis cinerea</option>
+            <option value="candida_albicans ">Candida albicans</option>
+            <option value="candida_guilliermondii ">Candida guilliermondii</option>
+            <option value="candida_tropicalis ">Candida tropicalis</option>
+            <option value="chaetomium_globosum">Chaetomium globosum</option>
+            <option value="coccidioides_immitis ">Coccidioides immitis</option>
+            <option value="coprinus ">Coprinus cinereus</option>
+            <option value="coprinus_cinereus">Coprinus cinereus</option>
+            <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option>
+            <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option>
+            <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option>
+            <option value="debaryomyces_hansenii">Debaryomyces hansenii</option>
+            <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option>
+            <option value="eremothecium_gossypii">Eremothecium gossypii</option>
+            <option value="fusarium_graminearum ">Fusarium graminearum</option>
+            <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option>
+            <option value="(histoplasma)">Histoplasma capsulatum</option>
+            <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option>
+            <option value="laccaria_bicolor ">Laccaria bicolor</option>
+            <option value="lamprey">Petromyzon marinus</option>
+            <option value="leishmania_tarentolae">Leishmania tarentolae</option>
+            <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option>
+            <option value="magnaporthe_grisea ">Magnaporthe grisea</option>
+            <option value="neurospora_crassa">Neurospora crassa</option>
+            <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option>
+            <option value="pichia_stipitis">Pichia stipitis</option>
+            <option value="rhizopus_oryzae">Rhizopus oryzae</option>
+            <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option>
+            <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option>
+            <option value="(saccharomyces)">Saccharomyces cerevisiae</option>
+            <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option>
+            <option value="trichinella">Trichinella spiralis</option>
+            <option value="ustilago_maydis">Ustilago maydis</option>
+            <option value="yarrowia_lipolytica">Yarrowia lipolytica</option>
+            <option value="nasonia">Nasonia vitripennis</option>
+            <option value="tomato ">Solanum lycopersicum</option>
+            <option value="chlamydomonas">Chlamydomonas reinhardtii</option>
+            <option value="amphimedon ">Amphimedon queenslandica</option>
+            <option value="pneumocystis ">Pneumocystis jirovecii</option>
+        </param> 
+
+        <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand.">
+            <option value="both">both</option>
+            <option value="forward">forward</option>
+            <option value="backward">backward</option>
+        </param> 
+
+        <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help.">
+            <option value="complete">complete</option>
+            <option value="partial">partial</option>
+            <option value="intronless">intronless</option>
+            <option value="atleastone">atleastone</option>
+            <option value="exactlyone">exactlyone</option>
+        </param>
+
+	</inputs>
+	<outputs>
+        <data format="gtf" name="output">
+            <change_format>
+                <when input="gff" value="--gff3=on" format="gff" />
+            </change_format>
+        </data>
+    </outputs>
+    <requirements>
+        <requirement type="binary">augustus</requirement>
+    </requirements>
+    <help>
+
+**What it does**
+
+AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller.
+It can be used as an ab initio program, which means it bases its prediction purely on the
+sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources
+such as EST, MS/MS, protein alignments and synthenic genomic alignments.
+
+-----	
+
+**Parameters**
+
+Gene Model::
+
+    partial      : allow prediction of incomplete genes at the sequence boundaries (default)
+    intronless   : only predict single-exon genes like in prokaryotes and some eukaryotes
+    complete     : only predict complete genes
+    atleastone   : predict at least one complete gene
+    exactlyone   : predict exactly one complete gene
+
+
+
+**Example**
+
+Suppose you have the following DNA formatted sequences::
+
+    >Seq1
+    cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
+    ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
+    cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
+    cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
+    ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
+
+Running this tool will produce this::
+
+    # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) -----
+    #
+    # Constraints/Hints:
+    # (none)
+    # Predicted genes for sequence number 1 on both strands
+    # start gene g1
+    scaffold1|size1992969	AUGUSTUS	gene	17453	19382	0.11	+	.	g6
+    scaffold1|size1992969	AUGUSTUS	transcript	17453	19382	0.11	+	.	g6.t1
+    scaffold1|size1992969	AUGUSTUS	start_codon	17453	17455	.	+	0	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	intron	17615	17660	0.38	+	.	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	intron	17708	17772	0.54	+	.	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	intron	17902	18035	0.58	+	.	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	intron	18313	18367	0.99	+	.	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	intron	19014	19080	0.44	+	.	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	17453	17614	0.55	+	0	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	17661	17707	0.38	+	0	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	17773	17901	0.54	+	1	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	18036	18312	0.52	+	1	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	18368	19013	0.99	+	0	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	CDS	19081	19379	0.31	+	2	transcript_id "g6.t1"; gene_id "g6";
+    scaffold1|size1992969	AUGUSTUS	stop_codon	19380	19382	.	+	0	transcript_id "g6.t1"; gene_id "g6";
+
+
+**References**
+
+Mario Stanke and Stephan Waack (2003) 
+Gene Prediction with a Hidden-Markov Model and a new Intron Submodel. 
+Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225
+
+
+	</help>
+</tool>