Mercurial > repos > bjoern-gruening > augustus
diff augustus.xml @ 2:d5d5999ff4f1
change directory structure
author | Bjoern Gruening <bjoern@gruenings.eu> |
---|---|
date | Thu, 15 Mar 2012 10:09:28 +0100 |
parents | augustus/augustus.xml@5663d1a1b29c |
children | 02e9daf33c24 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/augustus.xml Thu Mar 15 10:09:28 2012 +0100 @@ -0,0 +1,186 @@ +<tool id="augustus" name="Augustus" version="0.1"> + <description>gen prediction for eukaryotic genomes</description> + <command>augustus + --strand=$strand + $noInFrameStop + $gff + $protein + $introns + $start + $stop + $cds + $codingseq + $singlestrand + $input_genome + --genemodel=$genemodel + --species=$organism + --outfile=$output + + #please set export AUGUSTUS_CONFIG_PATH=/path_to_augustus/augustus/config + #or use the --AUGUSTUS_CONFIG_PATH=path switch + + </command> + <inputs> + <param name="input_genome" type="data" format="fasta" label="Genome Sequence"/> + <param name="noInFrameStop" type="boolean" label="Don't report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur" truevalue="--noInFrameStop=true" falsevalue="--noInFrameStop=false" checked="false" /> + <param name="gff" type="boolean" label="GFF formated output, standard is GTF" truevalue="--gff3=on" falsevalue="--gff3=off" checked="false" /> + <param name="protein" type="boolean" label="Output predicted protein sequences" truevalue="--protein=on" falsevalue="--protein=off" checked="false" /> + <param name="introns" type="boolean" label="Output predicted intron sequences" truevalue="--introns=on" falsevalue="--introns=off" checked="false" /> + <param name="start" type="boolean" label="Output predicted start codons" truevalue="--start=on" falsevalue="--start=off" checked="false" /> + <param name="stop" type="boolean" label="Output predicted stop codons" truevalue="--stop=on" falsevalue="--stop=off" checked="false" /> + <param name="cds" type="boolean" label="Output CDS region" truevalue="--cds=on" falsevalue="--cds=off" checked="true" /> + <param name="codingseq" type="boolean" label="Output coding sequence as comment in the output file" truevalue="--codingseq=on" falsevalue="--codingseq=off" checked="false" /> + + <param name="singlestrand" type="boolean" label="Predict genes independently on each strand, allow overlapping genes on opposite strands" truevalue="--singlestrand=true" falsevalue="--singlestrand=false" checked="false" /> + + <param name="organism" label="Model Organism" type="select" multiple="false" format="text" help="Choose a specialised trainingset."> + <option value="human">Homo sapiens</option> + <option value="fly">Drosophila melanogaster</option> + <option value="arabidopsis">Arabidopsis thaliana</option> + <option value="brugia ">Brugia malayi</option> + <option value="aedes">Aedes aegypti</option> + <option value="tribolium">Tribolium castaneum</option> + <option value="schistosoma">Schistosoma mansoni</option> + <option value="tetrahymena">Tetrahymena thermophila</option> + <option value="galdieria">Galdieria sulphuraria</option> + <option value="maize">Zea mays</option> + <option value="toxoplasma ">Toxoplasma gondii</option> + <option value="caenorhabditis ">Caenorhabditis elegans</option> + <option value="aspergillus_fumigatus">Aspergillus fumigatus</option> + <option value="aspergillus_nidulans ">Aspergillus nidulans</option> + <option value="aspergillus_oryzae ">Aspergillus oryzae</option> + <option value="aspergillus_terreus">Aspergillus terreus</option> + <option value="botrytis_cinerea ">Botrytis cinerea</option> + <option value="candida_albicans ">Candida albicans</option> + <option value="candida_guilliermondii ">Candida guilliermondii</option> + <option value="candida_tropicalis ">Candida tropicalis</option> + <option value="chaetomium_globosum">Chaetomium globosum</option> + <option value="coccidioides_immitis ">Coccidioides immitis</option> + <option value="coprinus ">Coprinus cinereus</option> + <option value="coprinus_cinereus">Coprinus cinereus</option> + <option value="cryptococcus_neoformans_gattii ">Cryptococcus neoformans gattii</option> + <option value="cryptococcus_neoformans_neoformans_B ">Cryptococcus neoformans neoformans</option> + <option value="cryptococcus_neoformans_neoformans_JEC21 ">Cryptococcus neoformans neoformans</option> + <option value="debaryomyces_hansenii">Debaryomyces hansenii</option> + <option value="encephalitozoon_cuniculi_GB">Encephalitozoon cuniculi</option> + <option value="eremothecium_gossypii">Eremothecium gossypii</option> + <option value="fusarium_graminearum ">Fusarium graminearum</option> + <option value="histoplasma_capsulatum ">Histoplasma capsulatum</option> + <option value="(histoplasma)">Histoplasma capsulatum</option> + <option value="kluyveromyces_lactis ">Kluyveromyces lactis</option> + <option value="laccaria_bicolor ">Laccaria bicolor</option> + <option value="lamprey">Petromyzon marinus</option> + <option value="leishmania_tarentolae">Leishmania tarentolae</option> + <option value="lodderomyces_elongisporus">Lodderomyces elongisporus</option> + <option value="magnaporthe_grisea ">Magnaporthe grisea</option> + <option value="neurospora_crassa">Neurospora crassa</option> + <option value="phanerochaete_chrysosporium">Phanerochaete chrysosporium</option> + <option value="pichia_stipitis">Pichia stipitis</option> + <option value="rhizopus_oryzae">Rhizopus oryzae</option> + <option value="saccharomyces_cerevisiae_S288C ">Saccharomyces cerevisiae</option> + <option value="saccharomyces_cerevisiae_rm11-1a_1 ">Saccharomyces cerevisiae</option> + <option value="(saccharomyces)">Saccharomyces cerevisiae</option> + <option value="schizosaccharomyces_pombe">Schizosaccharomyces pombe</option> + <option value="trichinella">Trichinella spiralis</option> + <option value="ustilago_maydis">Ustilago maydis</option> + <option value="yarrowia_lipolytica">Yarrowia lipolytica</option> + <option value="nasonia">Nasonia vitripennis</option> + <option value="tomato ">Solanum lycopersicum</option> + <option value="chlamydomonas">Chlamydomonas reinhardtii</option> + <option value="amphimedon ">Amphimedon queenslandica</option> + <option value="pneumocystis ">Pneumocystis jirovecii</option> + </param> + + <param name="strand" type="select" multiple="false" format="text" help="Report predicted genes on both strands, just the forward or just the backward strand."> + <option value="both">both</option> + <option value="forward">forward</option> + <option value="backward">backward</option> + </param> + + <param name="genemodel" label="Gene Model" type="select" multiple="false" format="text" help="Gene Model to predict, for more information please refere to the help."> + <option value="complete">complete</option> + <option value="partial">partial</option> + <option value="intronless">intronless</option> + <option value="atleastone">atleastone</option> + <option value="exactlyone">exactlyone</option> + </param> + + </inputs> + <outputs> + <data format="gtf" name="output"> + <change_format> + <when input="gff" value="--gff3=on" format="gff" /> + </change_format> + </data> + </outputs> + <requirements> + <requirement type="binary">augustus</requirement> + </requirements> + <help> + +**What it does** + +AUGUSTUS is a gene prediction program for eukaryotes written by Mario Stanke and Oliver Keller. +It can be used as an ab initio program, which means it bases its prediction purely on the +sequence. AUGUSTUS may also incorporate hints on the gene structure coming from extrinsic sources +such as EST, MS/MS, protein alignments and synthenic genomic alignments. + +----- + +**Parameters** + +Gene Model:: + + partial : allow prediction of incomplete genes at the sequence boundaries (default) + intronless : only predict single-exon genes like in prokaryotes and some eukaryotes + complete : only predict complete genes + atleastone : predict at least one complete gene + exactlyone : predict exactly one complete gene + + + +**Example** + +Suppose you have the following DNA formatted sequences:: + + >Seq1 + cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg + ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag + cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc + cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc + ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg + +Running this tool will produce this:: + + # ----- prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- + # + # Constraints/Hints: + # (none) + # Predicted genes for sequence number 1 on both strands + # start gene g1 + scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6 + scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1 + scaffold1|size1992969 AUGUSTUS start_codon 17453 17455 . + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17615 17660 0.38 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17708 17772 0.54 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 17902 18035 0.58 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 18313 18367 0.99 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS intron 19014 19080 0.44 + . transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17453 17614 0.55 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17661 17707 0.38 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 17773 17901 0.54 + 1 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 18036 18312 0.52 + 1 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 18368 19013 0.99 + 0 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS CDS 19081 19379 0.31 + 2 transcript_id "g6.t1"; gene_id "g6"; + scaffold1|size1992969 AUGUSTUS stop_codon 19380 19382 . + 0 transcript_id "g6.t1"; gene_id "g6"; + + +**References** + +Mario Stanke and Stephan Waack (2003) +Gene Prediction with a Hidden-Markov Model and a new Intron Submodel. +Bioinformatics, Vol. 19, Suppl. 2, pages ii215-ii225 + + + </help> +</tool>