Mercurial > repos > bjoern-gruening > trna_prediction

comparison aragorn.xml @ 1:65d282ef088e draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author bjoern-gruening
date Tue, 19 Mar 2013 16:56:25 -0400
parents
children
comparison
equal deleted inserted replaced
0:b46d3df3eb9e 1:65d282ef088e
1 <tool id="aragorn_trna" name="Aragon" version="0.2">
2 <description>Prediction of tRNAs</description>
3 <requirements>
4 <requirement type="package" version="1.2.36">aragorn</requirement>
5 </requirements>
6 <command>
7 aragorn
8 $input
9 -gc$genbank_gencode
10 $tmRNA
11 $tRNA
12 $mtRNA
13 $mam_mtRNA
14 $topology
15 -o $output
16 $secondary_structure
17 $introns
18 </command>
19 <inputs>
20 <param name="input" type="data" format="fasta" label="Genome Sequence"/>
21 <param name="genbank_gencode" type="select" label="Genetic code">
22 <option value="1" select="True">1. Standard</option>
23 <option value="2">2. Vertebrate Mitochondrial</option>
24 <option value="3">3. Yeast Mitochondrial</option>
25 <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
26 <option value="5">5. Invertebrate Mitochondrial</option>
27 <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
28 <option value="9">9. Echinoderm Mitochondrial</option>
29 <option value="10">10. Euplotid Nuclear</option>
30 <option value="11">11. Bacteria and Archaea</option>
31 <option value="12">12. Alternative Yeast Nuclear</option>
32 <option value="13">13. Ascidian Mitochondrial</option>
33 <option value="14">14. Flatworm Mitochondrial</option>
34 <option value="15">15. Blepharisma Macronuclear</option>
35 <option value="16">16. Chlorophycean Mitochondrial</option>
36 <option value="21">21. Trematode Mitochondrial</option>
37 <option value="22">22. Scenedesmus obliquus mitochondrial</option>
38 <option value="23">23. Thraustochytrium Mitochondrial</option>
39 <option value="24">24. Pterobranchia mitochondrial</option>
40 </param>
41 <param name="topology" type="select" label="Topology">
42 <option value="-c">Assume that each sequence has a circular topology</option>
43 <option value="-l">Assume that each sequence has a linear topology</option>
44 </param>
45 <param name='tmRNA' type='boolean' label='Search for tmRNA genes (-m)' truevalue='-m' falsevalue='' checked="true" help='' />
46 <param name='tRNA' type='boolean' label='Search for tRNA genes (-t)' truevalue='-t' falsevalue='' checked="true" help='' />
47 <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes (-mt)' truevalue='-mt' falsevalue='' checked="false" help='-i switch ignored. Composite Metazoan mitochondrial genetic code used.' />
48 <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes (-mtmam)' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch ignored. -tv switch set. Mammalian mitochondrial genetic code used.' />
49 <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop ...' truevalue='-i' falsevalue='' checked="false" help='...with maximum length 3000 bases (-i).' />
50 <param name='secondary_structure' type='boolean' label='Print out secondary structure (-fasta,-fon)' truevalue='-fasta' falsevalue='-fon' checked="false" help='' />
51 </inputs>
52 <outputs>
53 <data name="output" format="fasta">
54 <change_format>
55 <when input="secondary_structure" value="true" format="text"/>
56 </change_format>
57 </data>
58 </outputs>
59 <tests>
60 <test>
61 </test>
62 </tests>
63 <help>
64
65 **What it does**
66
67 This tool predicts, tRNA (and tmRNA) detection in nucleotide sequences.
68 http://130.235.46.10/ARAGORN/
69 -----
70
71 **Example**
72
73 Suppose you have the following DNA formatted sequences::
74
75 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
76 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
77 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
78 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
79 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
80 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
81
82 Running this tool will produce this::
83 --snip--
84 87.
85
86 c
87 c
88 a
89 g-c
90 g-c
91 g-c
92 c-g
93 g-c
94 a-t
95 t-a ca
96 t tgacc a
97 ga a !!!!! g
98 t ctcg actgg c
99 g !!!! c tt
100 g gagc t
101 aa g g
102 c-gag
103 t-a
104 t-a
105 c-g
106 g-c
107 t c
108 t a
109 cac
110
111
112
113 tRNA-Val(cac)
114 74 bases, %GC = 58.1
115 Sequence [6669703,6669776]
116
117
118
119
120 tRNA Anticodon Frequency
121 AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
122 AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
123 ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
124 ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
125 AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
126 AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
127 ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
128 ATG His GTG His 2 CTG Gln 2 TTG Gln 1
129 AAC Val GAC Val 3 CAC Val 2 TAC Val 1
130 AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
131 ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
132 ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
133 AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
134 AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
135 ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
136 ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
137 Ambiguous: 1
138
139 tRNA Codon Frequency
140 TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
141 TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
142 TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
143 TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
144 CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
145 CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
146 CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
147 CAT His CAC His 2 CAG Gln 2 CAA Gln 1
148 GTT Val GTC Val 3 GTG Val 2 GTA Val 1
149 GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
150 GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
151 GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
152 ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
153 ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
154 AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
155 AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
156 Ambiguous: 1
157
158 Number of tRNA genes = 86
159 tRNA GC range = 50.0% to 85.1%
160 Number of tmRNA genes = 1
161
162 -------
163
164 **References**
165
166 Dean Laslett and Bjorn Canback
167 ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
168 doi:10.1093/nar/gkh152
169
170
171
172 </help>
173 </tool>