Mercurial > repos > bjoern-gruening > trna_prediction

comparison tools/aragorn.xml @ 0:b46d3df3eb9e

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Initial commit
author bjoern-gruening
date Wed, 11 Jan 2012 05:57:32 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:b46d3df3eb9e
1 <tool id="aragorn_trna" name="Aragon" version="0.1">
2 <description>Prediction of tRNAs</description>
3 <command>aragorn $input > $output</command>
4 <inputs>
5 <param name="input" type="data" format="fasta" label="Genome Sequence"/>
6 </inputs>
7 <outputs>
8 <data name="output" format="tabular"/>
9 </outputs>
10 <tests>
11 <test>
12 </test>
13 </tests>
14 <help>
15
16 **What it does**
17
18 This tool predicts, tRNA (and tmRNA) detection in nucleotide sequences.
19 http://130.235.46.10/ARAGORN/
20 -----
21
22 **Example**
23
24 Suppose you have the following DNA formatted sequences::
25
26 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
27 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
28 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
29 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
30 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
31 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
32
33 Running this tool will produce this::
34 --snip--
35 87.
36
37 c
38 c
39 a
40 g-c
41 g-c
42 g-c
43 c-g
44 g-c
45 a-t
46 t-a ca
47 t tgacc a
48 ga a !!!!! g
49 t ctcg actgg c
50 g !!!! c tt
51 g gagc t
52 aa g g
53 c-gag
54 t-a
55 t-a
56 c-g
57 g-c
58 t c
59 t a
60 cac
61
62
63
64 tRNA-Val(cac)
65 74 bases, %GC = 58.1
66 Sequence [6669703,6669776]
67
68
69
70
71 tRNA Anticodon Frequency
72 AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
73 AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
74 ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
75 ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
76 AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
77 AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
78 ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
79 ATG His GTG His 2 CTG Gln 2 TTG Gln 1
80 AAC Val GAC Val 3 CAC Val 2 TAC Val 1
81 AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
82 ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
83 ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
84 AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
85 AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
86 ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
87 ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
88 Ambiguous: 1
89
90 tRNA Codon Frequency
91 TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
92 TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
93 TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
94 TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
95 CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
96 CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
97 CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
98 CAT His CAC His 2 CAG Gln 2 CAA Gln 1
99 GTT Val GTC Val 3 GTG Val 2 GTA Val 1
100 GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
101 GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
102 GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
103 ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
104 ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
105 AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
106 AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
107 Ambiguous: 1
108
109 Number of tRNA genes = 86
110 tRNA GC range = 50.0% to 85.1%
111 Number of tmRNA genes = 1
112
113 -------
114
115 **References**
116
117 Dean Laslett and Bjorn Canback
118 ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
119 doi:10.1093/nar/gkh152
120
121
122
123 </help>
124 </tool>