# HG changeset patch
# User bonsai
# Date 1367341955 14400
# Node ID 2e7f0da431e319ca1db7e92523108bf8e29a082f
Uploaded version 1.0
diff -r 000000000000 -r 2e7f0da431e3 merge_paired_reads.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/merge_paired_reads.xml Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,38 @@
+
+
+ sortmerna
+
+ Merges two fastq paired-reads files into one file.
+
+merge-paired-reads.sh $input_reads1 $input_reads2 output_file.txt
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+Merges two fastq paired-reads files into one file.
+
+To run merge-paired-reads::
+
+ bash merge-paired-reads.sh file1.fastq file2.fastq outputfile.fastq
+
+
\ No newline at end of file
diff -r 000000000000 -r 2e7f0da431e3 sortmerna.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/sortmerna.txt Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,15 @@
+Galaxy tool to execute SortMeRNA
+================================
+
+This tool is a wrapper for SortMeRNA, a fast and accurate filtering of
+ribosomal RNAs in metatranscriptomic data.
+
+See http://bioinfo.lifl.fr/RNA/sortmerna/ for more information.
+
+
+Automated Installation
+======================
+
+Galaxy should automatically download and install SortMeRNA.
+
+
diff -r 000000000000 -r 2e7f0da431e3 sortmerna_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/sortmerna_wrapper.py Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,72 @@
+#!/usr/bin/env python
+
+"""
+Runs SortMeRNA
+"""
+
+import subprocess
+import optparse
+import shlex
+
+
+def main():
+ """Parse the command line, exectutes SortMeRNA and buildtrie if neeeded."""
+ #TODO: Put all SortMeRNA options in the command-line parser
+ parser = optparse.OptionParser()
+ parser.add_option('--sortmerna', dest='sortmerna_cmd', help='')
+ parser.add_option('--buildtrie', dest='buildtrie',
+ default=False, action='store_true', help='')
+ (options, args) = parser.parse_args()
+ if not args:
+ raise Exception('Please provide at least one database')
+
+ if options.buildtrie:
+ buildtrie = 'buildtrie'
+ for database in args:
+ run_buildtrie([buildtrie, '--db', database])
+
+ if options.sortmerna_cmd:
+ sortmerna = 'sortmerna'
+ run_sortmerna([sortmerna] +
+ shlex.split(options.sortmerna_cmd) +
+ ['-m', '262144', '-n', str(len(args)), '--db'] +
+ args)
+
+
+def run_buildtrie(cmd):
+ """Run the BuildTrie program."""
+ try:
+ stdout_arg = subprocess.PIPE
+ stderr_arg = subprocess.PIPE
+ child_process = subprocess.Popen(args=" ".join(cmd), shell=True,
+ stdin=None, stdout=stdout_arg,
+ stderr=stderr_arg)
+ stdout_str, stderr_str = child_process.communicate()
+ return_code = child_process.returncode
+ if return_code is not 0:
+ raise Exception(stderr_str)
+
+ except Exception, error:
+ raise Exception('Error while running Buildtrie:\n' +
+ '\n'.join([str(error), stdout_str, stderr_str]))
+
+
+def run_sortmerna(cmd):
+ """Run the SortMeRNA program."""
+ try:
+ stdout_arg = subprocess.PIPE
+ stderr_arg = subprocess.PIPE
+ child_process = subprocess.Popen(args=" ".join(cmd), shell=True,
+ stdin=None, stdout=stdout_arg,
+ stderr=stderr_arg)
+ stdout_str, stderr_str = child_process.communicate()
+ return_code = child_process.returncode
+ if return_code is not 0:
+ raise Exception(stderr_str)
+ except Exception, error:
+ raise Exception('Error while running SortMeRNA:\n' +
+ '\n'.join([str(error), stdout_str, stderr_str]))
+
+
+if __name__ == "__main__":
+ main()
diff -r 000000000000 -r 2e7f0da431e3 sortmerna_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/sortmerna_wrapper.xml Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,354 @@
+
+
+
+ sortmerna
+
+ Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data
+
+sortmerna_wrapper.py
+--sortmerna "
+$strand_search
+#if str( $read_family.read_family_selector ) == 'other':
+ --I $input_reads -r $read_family.ratio_parameter
+#else:
+ $read_family.read_family_selector $input_reads
+#end if
+#if str( $sequencing_type.sequencing_type_selector ) == 'paired':
+ $sequencing_type.paired_type
+#end if
+
+#if $outputs_selected:
+ #if 'accept' in $outputs_selected.value:
+ --accept accept_file
+ #end if
+ #if 'other' in $outputs_selected.value:
+ --other other_file
+ #end if
+#end if
+$log
+#if str( $options.options_type_selector ) == 'more':
+ -a $options.number_of_threads
+#end if
+"
+#if str( $databases_type.databases_selector ) == 'history':
+ --buildtrie
+ #for $db in $databases_type.input_databases
+ $db.database_name
+ #end for
+#else:
+ ## databases path is not directly accessible, must match by hand with LOC file contents
+ ${' '.join([dict([(x[0], x[2]) for x in $databases_type.input_databases.input.options.tool_data_table.data])[y]
+ for y in $databases_type.input_databases.value])}
+#end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ outputs_selected and 'accept' in outputs_selected
+
+
+ outputs_selected and 'other' in outputs_selected
+
+
+ log
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**Overview**
+
+SortMeRNA_ is a software designed to rapidly filter ribosomal RNA fragments
+from metatransriptomic data produced by next-generation sequencers.
+It is capable of handling large RNA databases and sorting out all fragments
+matching to the database with high accuracy and specificity.
+
+.. _SortMeRNA: http://bioinfo.lifl.fr/RNA/sortmerna/
+
+If you use this tool, please cite Kopylova E., Noé L. and Touzet H.,
+`"SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data"`__,
+Bioinformatics (2012), doi: 10.1093/bioinformatics/bts611.
+
+.. __: http://bioinformatics.oxfordjournals.org/content/28/24/3211
+
+------
+
+**Input**
+
+The input is one file of reads in FASTA or FASTQ format and any number of rRNA databases to search against.
+If the user has two foward-reverse paired-sequencing reads files, they may use
+the script "merge_paired_reads.sh" to interleave the reads into one file, preserving their order.
+
+If the sequencing type for the reads is paired-ended, the user has two options under
+"Sequencing type" to filter the reads and preserve their order in the file.
+For a further example of each option, please refer to Section 4.2.3 in the `SortMeRNA User Manual`_.
+
+.. _sortmerna user manual: http://bioinfo.lifl.fr/RNA/sortmerna/code/SortMeRNA-user-manual-v1.7.pdf
+
+------
+
+**Output**
+
+The output will follow the same format (FASTA or FASTQ) as the reads.
+
+In the standalone version of SortMeRNA, the user may output the matching reads in a separate file per database (--bydbs option). This option will be made available in a future version of Galaxy.
+
+------
+
+**rRNA databases**
+
+SortMeRNA is distributed with 8 representative rRNA databases, which were
+all constructed from the SILVA SSU,LSU (version 111) and the RFAM 5/5.8S
+(version 11.0) databases using the tool UCLUST.
+
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| Representative database | id % | avergage id% | # seq | Origin | # seq | filtered to remove |
++==========================+======+==============+=======+========================+========+====================+
+| SILVA 16S bacteria | 85 | 91.6 | 8174 | SILVA SSU Ref NR v.111 | 244077 | 23s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| SILVA 16S archaea | 95 | 96.7 | 3845 | SILVA SSU Ref NR v.111 | 10919 | 23s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| SILVA 18S eukarya | 95 | 96.7 | 4512 | SILVA SSU Ref NR v.111 | 31862 | 26s,28s,23s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| SILVA 23S bacteria | 98 | 99.4 | 3055 | SILVA LSU Ref v.111 | 19580 | 16s,26s,28s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| SILVA 23s archaea | 98 | 99.5 | 164 | SILVA LSU Ref v.111 | 405 | 16s,26s,28s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| SILVA 28S eukarya | 98 | 99.1 | 4578 | SILVA LSU Ref v.111 | 9321 | 18s |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| Rfam 5S archaea/bacteria | 98 | 99.2 | 59513 | RFAM | 116760 | |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+| Rfam 5.8S eukarya | 98 | 98.9 | 13034 | RFAM | 225185 | |
++--------------------------+------+--------------+-------+------------------------+--------+--------------------+
+
+
+id % :
+ members of the cluster must have identity at least 'id %' identity with the representative sequence
+
+average id % :
+ average identity of a cluster member to the representative sequence
+
+The user may also choose to use their own rRNA databases.
+
+.. class:: warningmark
+
+Note that your personal databases are indexed each time, and that
+this may take some time depending on the size of the given database.
+
+------
+
+**SortMeRNA parameter list**
+
+The standalone, command-line version of SortMeRNA uses the following parameters.
+
+For indexing (buildtrie):
+
+This program builds a Burst trie on an input rRNA database file in fasta format
+and stores the material in binary files under the folder '/automata'::
+
+ ./buildtrie --db [path to rrnas database file name {.fasta}] {OPTIONS}
+
+The list of OPTIONS can be left blank, the default values will be used::
+
+ -L length of the sliding window (the seed)
+ (default: 18)
+
+ -F search only the forward strand
+ -R search only the reverse-complementary strand
+ (default: both strands are searched)
+
+ -h help
+
+
+
+
+For sorting (sortmerna):
+
+To run SortMeRNA, type in any order after 'sortmerna'::
+
+ --I [illumina reads file name {fasta/fastq}]
+
+ --454 [roche 454 reads file name {fasta/fastq}]
+
+ -n number of databases to use (must precede --db)
+
+ --db [rrnas database name(s)]
+
+ One database,
+ ex 1. -n 1 --db /path1/database1.fasta
+
+ Multiple databases,
+ ex 2. -n 2 --db /path2/database2.fasta /path3/database3.fasta
+
+ {OPTIONS}
+
+The list of OPTIONS can be left blank, the default values will be used::
+
+ --accept [accepted reads file name]
+ --other [rejected reads file name]
+ (default: no output file is created)
+
+ --bydbs output the accepted reads by database
+ (default: concatenated file of reads)
+
+ --log [overall statistics file name]
+ (default: no statistics file created)
+
+ --paired-in put both paired-end reads into --accept file
+ --paired-out put both paired-end reads into --other file
+ (default: if one read is accepted and the other is not,
+ separate the reads into --accept and --other files)
+
+ -r ratio of the number of hits on the read / read length
+ (default Illumina: 0.25, Roche 454: 0.15)
+
+ -F search only the forward strand
+ -R search only the reverse-complementary strand
+ (default: both strands are searched)
+
+ -a number of threads to use
+ (default: 1)
+
+ -m (m x 4096 bytes) for loading the reads into memory
+ ex. '-m 4' means 4*4096 = 16384 bytes will be allocated for the reads
+ note: maximum -m is 1020039
+ (default: m = 262144 = 1GB)
+
+ -v verbose
+ (default: deactivated)
+
+ -h help
+
+ --version version number
+
+------
+
+**Bibliography**
+
+[1] Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO (2013) The SILVA ribosomal RNA gene database project: improved data processing and web-based tools, Nucleic Acids Research, 41 (D1): D590-D596.
+
+[2] Rfam 11.0: 10 years of RNA families. S.W. Burge, J. Daub, R. Eberhardt, J. Tate, L. Barquist, E.P. Nawrocki, S.R. Eddy, P.P. Gardner, A. Bateman. Nucleic Acids Research (2012), doi: 10.1093/nar/gks1005
+
+[3] Edgar, R.C. (2010) Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26(19), 2460-2461, doi: 10.1093/bioinformatics/btq461
+
+[4] Loman, N. J. and Misra, Raju V and Dallman, Timothy J and Constantinidou, Chrystala and Gharbia, Saheer E and Wain, John and Pallen, Mark J., Performance comparison of benchtop high-throughput sequencing platforms (2012), Nature Biotechnology, 30 (5). pp. 434-439
+
+
diff -r 000000000000 -r 2e7f0da431e3 test-data/merged-paired-reads_output.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merged-paired-reads_output.fastq Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,50 @@
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
+
diff -r 000000000000 -r 2e7f0da431e3 test-data/sortmerna_wrapper_accept1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_accept1.fastq Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,28 @@
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
diff -r 000000000000 -r 2e7f0da431e3 test-data/sortmerna_wrapper_in1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_in1.fastq Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,48 @@
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+CTCGCGCCACTGGCTGGCTCTCCCCTCTCTCTCTCTCTCTCCCCTCTCTCTCCCCGAGTACACCCGCGCGGGC
++PHOSPHORE_0118:4:1101:5073:2473#ATCACG/1
+___cccccggggghhhhf_YbcgecZYa^Y^ceXccacXIXaafX`_]VMHVbdhSTFKU_Z]b]WFW_aZ__
+@PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+GCGGTCTGGAACCACCTGATCCCATCCCGAACTCAGCCGTGAAACAGACCAGCGCCGATGGTAGTGTGGCTTCTGCCCGT
++PHOSPHORE_0118:4:1101:17780:2432#ATCACG/1
+bbbeeeeegggggiiiiiiihiiihiiiiiiihiidhhigfhihiihgiiiiiggeccaccbbb_b`baccab`]_ba[T
+@PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+GCATCGCCGCCCTCGCCCTCGCCCCCGCCGCCCTCGCCCT
++PHOSPHORE_0118:4:1101:7859:3729#ATCACG/1
+___c`cc`Yeee[ePY_`UY^_eGL_F_`dUU\F\^Q\a_
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+CCCCACTCACCACGCACGGCACCGCACGGCACTCTCACGGTTTCTCTCTCTCTCTCCCATCCTTCTCACTCCTTTCTCTCTCTCCCTATCTCTCTCTCTC
++PHOSPHORE_0118:4:1101:7007:4197#ATCACG/1
+bbbeeeeeggggghiiiiihfhifhhiihiagfhiiiiig^dceeeedcddddcccccRZ``bbcbcbbR_bb`b`bb`bbb`bbcbR]b_]]`bb_b_b
+@PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+AGCCTGACGATAACCTACTTTCACACTGGTTGCAGCACTATCATCGGCGCAAAGTCGTTTCACGGTCCTGTTCGGGATGGGAAGGGGTGGGACCGACTTGC
++PHOSPHORE_0118:4:1101:7113:4916#ATCACG/1
+bbbeeeeegggggiiiiiiiiiihiiiiigiiiiiiiiiiiiiiiiiiiihiiggggeeeeddccccccccccccccccccbbccccHXaacccc]acacb
+@PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+GCCGAAGAAGGACGTGGGAATCTGCGATAAGCCTGGTGGAGTCGATAACCGGACGTTGAGACCAGGATTTCCGAATGGGGAAACCCCGCACGACGTGTCGT
++PHOSPHORE_0118:4:1101:11597:5204#ATCACG/1
+bbbeeeeegggggifgiiiiiiiiiihiihiiiiiicfhgheghiiihihggcecccccccccccccccccccccccccccaacccaccc__[_a[a^[_Q
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
+@PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+GCGCTCGAGGAGGACGTGGCGCCCGAGGCTGCCGAGGCTG
++PHOSPHORE_0118:4:1101:13427:6518#ATCACG/1
+Z__cccc`ecg^_fe^[^^^Y_ffc]_`[eZ_c_W\]]b`
diff -r 000000000000 -r 2e7f0da431e3 test-data/sortmerna_wrapper_other1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sortmerna_wrapper_other1.fastq Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,20 @@
+@PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+CGCGCGCACCATGCCCGTGCTCGACTGCTCGCCGCCCGCGCCGCGCCACGCCTCGCCGTTCACCTTGACCTCCACGCGCAGGCC
++PHOSPHORE_0118:4:1101:1143:2236#ATCACG/1
+__beeeecggcgfhhhhhhhhhhfhhhhhhhhhhhgececcccccccacaccccaccccac`bbbcbbbcbbc[`_a[aLT[aa
+@PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+ATGCGCTTGAGGTAGCCAAGGGCACGCAGTTCACACCGTATGGCGGCGATGCGAGGCGGCGGCAGGAGG
++PHOSPHORE_0118:4:1101:1397:2156#ATCACG/1
+bbbeeeeegggggiiiiiiiiihfhiheghihgihiiihiiiiihifc^acac^_cEHVZaccaac^__
+@PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+TGACCAATGTTCTTCATAACGTCCCCGATAGACATGCCAACATTCGGTCCGTTGCGAAGATAGTCATCGCCGTCATAGTC
++PHOSPHORE_0118:4:1101:1633:2146#ATCACG/1
+_bbecdecgggggihhiiiihghhhiihiichdfghiffghfghiifiifhhhiiggaaaddddbdd`bccaQ\a`bc_b
+@PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+GCATGCCAAACGTGGAGGCGGTGGGCGCGACGCCGGTGGGGAACTTGGACTTGTACATGGCCGGCCGCTGCGTCACCATCGA
++PHOSPHORE_0118:4:1101:1719:2154#ATCACG/1
+bbbeeeeeggggegifhiiii^fgh\edgffeeccc\acccWV_ccccbccccbbdccccccccaaacaZ]acaa^bccccb
+@PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+GTTCGATTAGTCTTTCGCCCCTATACCCAAATTTGACGATCGATTTGCACGTCAGAATCGCTAC
++PHOSPHORE_0118:4:1101:1730:2193#ATCACG/1
+baaeeeeeggggghhifhiiihfgbghhhiihihfhihfhihdfghhiiifhiihdbfgddged
diff -r 000000000000 -r 2e7f0da431e3 tool-data/rRNA_databases.loc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/rRNA_databases.loc Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,8 @@
+rfam-5.8s Database Rfam 5.8s $SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta
+rfam-5s Database Rfam 5s $SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta
+silva-arc-16s Database Silva-Arc 16s $SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta
+silva-arc-23s Database Silva-Arc 23s $SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta
+silva-bac-16s Database Silva-Bac 16s $SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta
+silva-bac-23s Database Silva-Bac 23s $SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta
+silva-euk-18s Databse Silva-Euk 18s $SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta
+silva-euk-28s Database Silva-Euk 28s $SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta
diff -r 000000000000 -r 2e7f0da431e3 tool-data/rRNA_databases.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/rRNA_databases.loc.sample Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that is used to define a
+#list of public ribosomal databases, using three columns tab separated
+#(longer whitespace are TAB characters):
+#
+#
+#
+#It is important that the actual database name does not have a space in it,
+#and that the first tab that appears in the line is right before the path.
+#
+#So, for example, if your database is rfam-5.8s and the path to your base name
+#is /data/rRNA_databases/rfam-5.8s, then the rRNA_databases.loc entry would look like this:
+#
+#rfam-5.8s Rfam 5.8S eukarya /data/rRNA_databases/rfam-5.8s
+#
+#Since SortMeRNA comes bundled with eight ribosomal databases, which are ready
+#for use after the tool installation, this sample file is in fact an actual file
+#to save the user the trouble of setting it.
+#
+rfam-5.8s Rfam 5.8S eukarya $SORTMERNADIR/rRNA_databases/rfam-5.8s-database-id98.fasta
+rfam-5s Rfam 5S archaea/bacteria $SORTMERNADIR/rRNA_databases/rfam-5s-database-id98.fasta
+silva-arc-16s SILVA 16S archaea $SORTMERNADIR/rRNA_databases/silva-arc-16s-database-id95.fasta
+silva-arc-23s SILVA 16S bacteria $SORTMERNADIR/rRNA_databases/silva-arc-23s-database-id98.fasta
+silva-bac-16s SILVA 16S bacteria $SORTMERNADIR/rRNA_databases/silva-bac-16s-database-id85.fasta
+silva-bac-23s SILVA 23S bacteria $SORTMERNADIR/rRNA_databases/silva-bac-23s-database-id98.fasta
+silva-euk-18s SILVA 18S eukarya $SORTMERNADIR/rRNA_databases/silva-euk-18s-database-id95.fasta
+silva-euk-28s SILVA 28S eukarya $SORTMERNADIR/rRNA_databases/silva-euk-28s-database-id98.fasta
diff -r 000000000000 -r 2e7f0da431e3 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,7 @@
+
+
+
+ value, name, path
+
+
+
diff -r 000000000000 -r 2e7f0da431e3 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Tue Apr 30 13:12:35 2013 -0400
@@ -0,0 +1,42 @@
+
+
+
+
+
+ http://bioinfo.lifl.fr/RNA/sortmerna/code/sortmerna-1.7.tar.gz
+ ./configure
+ make
+ make check
+
+ sortmerna
+ $INSTALL_DIR/bin
+
+
+ buildtrie
+ $INSTALL_DIR/bin
+
+
+ scripts/merge-paired-reads.sh
+ $INSTALL_DIR/bin
+
+
+ rRNA_databases
+ $INSTALL_DIR/rRNA_databases
+
+
+ automata
+ $INSTALL_DIR/automata
+
+
+ $INSTALL_DIR
+
+
+ $INSTALL_DIR/bin
+
+
+
+
+SortMeRNA requires g++ 4.3 or later. Installation may take a moment since ribosomal databases have to be indexed.
+
+
+