Mercurial > repos > boris > filter_on_md
view MDtag_filter.xml @ 1:f3d024fd9bf4 draft
Uploaded python script
author | boris |
---|---|
date | Tue, 24 Apr 2012 12:14:56 -0400 |
parents | 447b7748eb83 |
children |
line wrap: on
line source
<tool id="MDtag_filter" name="Filter mapped reads" version="1.0.2"> <description>on MD tag string</description> <command interpreter="python">MDtag_filter.py $in_sam $n $m $out_sam $saveDiscarded $discarded_sam</command> <inputs> <param format="sam" name="in_sam" type="data" label="Input SAM file"/> <param name="n" type="integer" value='0' label="5' end window (n)" help="Any number of mismatches within this window will cause the read to be discarded"/> <param name="m" type="integer" value='0' label="3' end window (m)" help="Any number of mismatches within this window will cause the read to be discarded"/> <param name="saveDiscarded" label="Save discarded reads in additional SAM file?" type="boolean" truevalue="yes" falsevalue="no" checked="False"/> </inputs> <outputs> <data format="sam" name="out_sam" label="MDtag_filter_(selected)_from_${in_sam.name}" metadata_source="in_sam"/> <data format="sam" name="discarded_sam" label="MDtag_filter_(discarded)_from_${in_sam.name}" metadata_source="in_sam"> <filter> saveDiscarded is True </filter> </data> </outputs> <tests> <test> <param name="in_sam" value="test_for_md_filter.sam"/> <param name="n" value="5"/> <param name="m" value="5"/> <output name="out_sam" file="test_md_filtered.sam"/> </test> <test> <param name="in_sam" value="test_for_md_filter.sam"/> <param name="n" value="5"/> <param name="m" value="5"/> <param name="saveDiscarded" value="yes"/> <output name="out_sam" file="test_md_selected.sam"/> <output name="discarded_sam" file="test_md_discarded.sam"/> </test> </tests> <help> Mismatches at either end of a mapped read are most likely sequencing errors. This tool aims to control the variation noise due to potential sequencing errors. ----- .. class:: infomark **What it does** This tool reads the MD tag of mapped reads (see SAM format specification). The user defines the 5' and 3' windows **n** and **m** (in bp), respectively. The mapped read is discarded if it contains any number of mismatches within **n** bases of the read 5' end and within **m** bases of the read 3' end. Option: save discarded reads in an additional SAM file. ----- .. class:: warningmark **Note** Mapped reads without an MD tag will be removed from the output SAM file(s). ----- .. class:: infomark **About formats** **SAM format** -- SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. Each alignment line has 11 **mandatory** fields:: 1. QNAME - Query template NAME 2. FLAG - bitwise FLAG 3. RNAME - Reference sequence NAME 4. POS - 1-based leftmost mapping POSition 5. MAPQ - MAPping Quality 6. CIGAR - CIGAR string 7. RNEXT - Ref. name of the mate/next segment 8. PNEXT - Position of the mate/next segment observed 9. TLEN - Template LENgth 10. SEQ - segment SEQuence 11. QUAL - ASCII of Phred-scaled base QUALity+33 All **optional** fields follow the TAG\:TYPE\:VALUE format, where TAG is a two-character string that matches [A-Za-z][A-Za-z0-9]. TYPE is a single case sensitive letter which defines the format of VALUE:: MD TAG MD:Z:[0-9]+(([A-Z]|\^[A-Z]+)[0-9]+)* with Z = Printable string, including space. String for mismatching positions. The MD field aims to achieve SNP/indel calling without looking at the reference. For example, a string ‘10A5^AC6’ means from the leftmost reference base in the alignment, there are 10 matches followed by an A on the reference which is different from the aligned read base; the next 5 reference bases are matches followed by a 2bp deletion from the reference; the deleted sequence is AC; the last 6 bases are matches. The MD field ought to match the CIGAR string. ----- **Example** - For the following dataset:: SRR057527.13746413 16 1 1164232 35 1I35M * 0 0 CGAAAGTGAGGTCCTGGCTCCAATCCAATCCCCGGG 333333033333333333333333333333333333 X0:i:1 X1:i:0 OC:Z:36M RG:Z:rnaseq XG:i:0 NM:i:2 XM:i:2 XO:i:0 OP:i:1164231 OQ:Z:CCCCCCDCCCCBCCCCCCCCCCCCCCCCCCCCCCCC XT:A:U SRR057527.8574994 16 1 565901 23 36M * 0 0 GAGCCTAATCTACTCCACCTCAATCACACTACTCCC 333333333333333303333333333333333333 X0:i:1 X1:i:1 XA:Z:MT,-5351,36M,2; MD:Z:1C34 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:CCCCCCCCCCCCCCCCDCCCCCCCCCCCCCCCCCCC XT:A:U SRR057528.178504 0 1 566573 23 36M * 0 0 ACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCA 233333323222222232333222222222222222 X0:i:1 X1:i:1 XA:Z:MT,+6023,36M,1; MD:Z:36 RG:Z:rnaseq XG:i:0 NM:i:0 XM:i:0 XO:i:0 OQ:Z::?CCCCBAB@AA@@A@B@??BA@A;AA@======:@ XT:A:U SRR057527.20391474 0 1 565512 23 36M * 0 0 GGCAGTTGAGGGGGATTAAACCAAACCCAACTACGC %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% X0:i:1 X1:i:1 XA:Z:MT,+4962,36M,2; MD:Z:11T24 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U SRR057513.2261668 16 1 16267 15 36M * 0 0 CACTTCTGGATGCTAGGGTTACACTGGGAGTCACAG 333333333333333333333333333333333333 X0:i:1 X1:i:6 MD:Z:30A5 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U - running this tool with **n = 5** and **m =10**, will return:: SRR057528.178504 0 1 566573 23 36M * 0 0 ACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCA 233333323222222232333222222222222222 X0:i:1 X1:i:1 XA:Z:MT,+6023,36M,1; MD:Z:36 RG:Z:rnaseq XG:i:0 NM:i:0 XM:i:0 XO:i:0 OQ:Z::?CCCCBAB@AA@@A@B@??BA@A;AA@======:@ XT:A:U SRR057527.20391474 0 1 565512 23 36M * 0 0 GGCAGTTGAGGGGGATTAAACCAAACCCAACTACGC %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% X0:i:1 X1:i:1 XA:Z:MT,+4962,36M,2; MD:Z:11T24 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U SRR057513.2261668 16 1 16267 15 36M * 0 0 CACTTCTGGATGCTAGGGTTACACTGGGAGTCACAG 333333333333333333333333333333333333 X0:i:1 X1:i:6 MD:Z:30A5 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U </help> </tool>