Mercurial > repos > bvalot > in_sillico_pcr

comparison primer_search.xml @ 0:1f4836da4a14 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/bvalot/galaxy commit d57c24d4b2c0c741d572af9ca0d09f8b82689640
author bvalot
date Tue, 14 Jun 2022 08:52:22 +0000
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:1f4836da4a14
1 <tool id="primer_search_wrapper" name="Primer Search" version="0.1">
2 <description></description>
3 <requirements>
4 <requirement type="package" version="1.28">gassst</requirement>
5 <requirement type="package" version="1.78">biopython</requirement>
6 </requirements>
7 <stdio>
8 <exit_code range="1:" level="fatal" />
9 </stdio>
10 <version_command>$__tool_directory__/primer_search.py -v</version_command>
11 <command>
12 $__tool_directory__/primer_search.py -o $output
13 #if str($error)
14 -e $error
15 #end if
16 #if str($min)
17 -m $min
18 #end if
19 #if str($max)
20 -M $max
21 #end if
22 #if $keep
23 -k
24 #end if
25 #if $remove
26 -r
27 #end if
28 $forward $reverse $database 2> $logfile
29 </command>
30 <inputs>
31 <param name="database" type="data" format="fasta" label="Database to search on fasta" help="FASTA format" />
32 <param name="forward" type="text" value="" optional="false" size="50"
33 label="Forward primer sequence"
34 help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
35 <param name="reverse" type="text" value="" optional="false" size="50"
36 label="Reverse primer sequence"
37 help="DNA sequence, letters corresponding to multiple nucleotide allowed" />
38 <param name="error" type="integer" value="1" optional="true"
39 label="Maximun error allowed on match" help="Number of mismatch allowed for each primer" />
40 <param name="min" type="integer" value="100" optional="true"
41 label="Min len amplicon size" help="Only amplicon with this minimun length were reported" />
42 <param name="max" type="integer" value="1500" optional="true"
43 label="Max len amplicon size" help="Only amplicon with this maximun length were reported" />
44 <param name="keep" type="boolean" checked="false"
45 label="If set, Keep description instead of report PCR position" />
46 <param name="remove" type="boolean" checked="false"
47 label="If set, remove primer sequance from reported amplicons" />
48 </inputs>
49 <outputs>
50 <data name="logfile" format="txt" label="${tool.name} on ${on_string}: log" />
51 <data name="output" format="fasta" label="${tool.name} on ${on_string}: fasta" />
52 </outputs>
53 <tests>
54 <test expect_num_outputs="2">
55 <param name="database" value="input.fasta" />
56 <param name="forward" value="ACCTGGTGTACGCCTCGCTGAC" />
57 <param name="reverse" value="GACATAGATGCCCTGCCCCTTGAT" />
58 <param name="error" value="2" />
59 <output name="output" file="pcr.fasta" ftype="fasta" />
60 </test>
61 </tests>
62 <help>
63 **What it does**
64
65 Search primer on database and return amplicons on fasta format.
66
67 **License and citation**
68
69 This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`.
70
71 This tool uses Gassst, which is licensed separately.
72 Please cite: Rizk G. and Dominique Lavenier D. (2010) GASSST: global alignment short sequence search tool. *Bioinformatics* 26(20), 2534-2540.
73 http://www.irisa.fr/symbiose/projects/gassst/
74 </help>
75 <citations>
76 <citation type="doi">10.1093/bioinformatics/btq485</citation>
77 </citations>
78 </tool>