Mercurial > repos > bvalot > in_sillico_pcr
diff primer_search.xml @ 0:1f4836da4a14 draft default tip
planemo upload for repository https://github.com/bvalot/galaxy commit d57c24d4b2c0c741d572af9ca0d09f8b82689640
| author | bvalot |
|---|---|
| date | Tue, 14 Jun 2022 08:52:22 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/primer_search.xml Tue Jun 14 08:52:22 2022 +0000 @@ -0,0 +1,78 @@ +<tool id="primer_search_wrapper" name="Primer Search" version="0.1"> + <description></description> + <requirements> + <requirement type="package" version="1.28">gassst</requirement> + <requirement type="package" version="1.78">biopython</requirement> + </requirements> + <stdio> + <exit_code range="1:" level="fatal" /> + </stdio> + <version_command>$__tool_directory__/primer_search.py -v</version_command> + <command> + $__tool_directory__/primer_search.py -o $output + #if str($error) + -e $error + #end if + #if str($min) + -m $min + #end if + #if str($max) + -M $max + #end if + #if $keep + -k + #end if + #if $remove + -r + #end if + $forward $reverse $database 2> $logfile + </command> + <inputs> + <param name="database" type="data" format="fasta" label="Database to search on fasta" help="FASTA format" /> + <param name="forward" type="text" value="" optional="false" size="50" + label="Forward primer sequence" + help="DNA sequence, letters corresponding to multiple nucleotide allowed" /> + <param name="reverse" type="text" value="" optional="false" size="50" + label="Reverse primer sequence" + help="DNA sequence, letters corresponding to multiple nucleotide allowed" /> + <param name="error" type="integer" value="1" optional="true" + label="Maximun error allowed on match" help="Number of mismatch allowed for each primer" /> + <param name="min" type="integer" value="100" optional="true" + label="Min len amplicon size" help="Only amplicon with this minimun length were reported" /> + <param name="max" type="integer" value="1500" optional="true" + label="Max len amplicon size" help="Only amplicon with this maximun length were reported" /> + <param name="keep" type="boolean" checked="false" + label="If set, Keep description instead of report PCR position" /> + <param name="remove" type="boolean" checked="false" + label="If set, remove primer sequance from reported amplicons" /> + </inputs> + <outputs> + <data name="logfile" format="txt" label="${tool.name} on ${on_string}: log" /> + <data name="output" format="fasta" label="${tool.name} on ${on_string}: fasta" /> + </outputs> + <tests> + <test expect_num_outputs="2"> + <param name="database" value="input.fasta" /> + <param name="forward" value="ACCTGGTGTACGCCTCGCTGAC" /> + <param name="reverse" value="GACATAGATGCCCTGCCCCTTGAT" /> + <param name="error" value="2" /> + <output name="output" file="pcr.fasta" ftype="fasta" /> + </test> + </tests> + <help> +**What it does** + +Search primer on database and return amplicons on fasta format. + +**License and citation** + +This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`. + +This tool uses Gassst, which is licensed separately. +Please cite: Rizk G. and Dominique Lavenier D. (2010) GASSST: global alignment short sequence search tool. *Bioinformatics* 26(20), 2534-2540. +http://www.irisa.fr/symbiose/projects/gassst/ + </help> + <citations> + <citation type="doi">10.1093/bioinformatics/btq485</citation> + </citations> +</tool>
