Mercurial > repos > cpt > cpt_fasta_remove_id
view fasta_remove_id.xml @ 4:90f549221976 draft default tip
planemo upload commit f33bdf952d796c5d7a240b132af3c4cbd102decc
| author | cpt |
|---|---|
| date | Fri, 05 Jan 2024 05:50:54 +0000 |
| parents | 03414db20efc |
| children |
line wrap: on
line source
<tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0"> <description>from fasta file</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements"/> <command detect_errors="aggressive"><![CDATA[ '$__tool_directory__/fasta_remove_id.py' @SEQUENCE@ > '$out' ]]> </command> <inputs> <expand macro="input/fasta"/> </inputs> <outputs> <data format="fasta" name="out"/> </outputs> <tests> <test> <param name="sequences" value="T7_RemIDIn.fasta"/> <output name="out" file="T7_RemIDOut.fasta"/> </test> </tests> <help> **What it does** From an input FASTA file, removes the "description" field (all characters after the first space in the top line until a return) after the FASTA ID (from the > to the first space). This is a permanent removal of the description. It is useful for tools that behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS. **Example Input/Output** For an input FASTA file:: >1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct >2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat The resulting FASTA will contain only IDs without a description:: >1|random acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct >2|random gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat </help> <expand macro="citations"/> </tool>
