Mercurial > repos > cpt > cpt_xmfa_to_table

diff cpt_convert_xmfa/test-data/test.xmfa @ 0:06d8e28d0bd7 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author cpt
date Fri, 10 Jun 2022 08:49:43 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/cpt_convert_xmfa/test-data/test.xmfa	Fri Jun 10 08:49:43 2022 +0000
@@ -0,0 +1,28 @@
+#FormatVersion Mauve1
+#Sequence1File	test.fa
+#Sequence1Entry	1
+#Sequence1Format	FastA
+#Sequence2File	test.fa
+#Sequence2Entry	2
+#Sequence2Format	FastA
+#Sequence3File	test.fa
+#Sequence3Entry	3
+#Sequence3Format	FastA
+#BackboneFile	test.xmfa.bbcols
+> 1:1-10 + test.fa
+-----GGGGGGGGGG
+> 2:1-10 + test.fa
+-----GGGGGGGGGG
+> 3:6-15 + test.fa
+-----GGGGGGAAGG
+=
+> 1:41-60 + test.fa
+AATGAATGAATGAATGAATG
+> 2:21-38 + test.fa
+AATGAATGAA--AATGAATG
+=
+> 1:21-25 + test.fa
+TTTTT
+> 3:21-25 + test.fa
+TTGGT
+=
\ No newline at end of file