--- a/check_id_map.xml	Sat Mar 09 22:05:13 2013 +0100
+++ b/check_id_map.xml	Sat Mar 09 22:27:31 2013 +0100
@@ -1,47 +1,49 @@
-<?xml version="1.0" ?>
-<tool id="check_id_map" name="Check ID Map" version="1.6.0-1">
+<!-- Author: Davide Albanese - Fondazione Edmud Mach, 2013 -->
+
+<tool id="check_id_map" name="Check ID Map" version="1.6.0-2">
   <description>
     Checks user's metadata mapping file for required data, valid
     format
   </description>
   <requirements>
-    <requirement type="package">qiime</requirement>
+    <requirement type="binary">check_id_map.py</requirement>
   </requirements>
-  <command>check_id_map.py
-  
-  -m $mapping_fp
-
-  #if str($char_replace):
-  -c $char_replace
-  #end if
-  
-  #if $not_barcoded:
-  -b
-  #end if
-  
-  #if $variable_len_barcodes:
-  -B
-  #end if
-
-  #if $disable_primer_check:
-  -p
-  #end if
-
-  #if str($added_demultiplex_field):
-  -j $added_demultiplex_field
-  #end if
-  ;
-  rm `basename $mapping_fp .txt`'.html'
-  ;
-  rm overlib.js
-  ;
-  mv `basename $mapping_fp .txt`'.log' $out_log
-  ;
-  mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
+  <command>
+    check_id_map.py
+    
+    -m $mapping_fp
+    
+    #if str($char_replace):
+    -c $char_replace
+    #end if
+    
+    #if $not_barcoded:
+    -b
+    #end if
+    
+    #if $variable_len_barcodes:
+    -B
+    #end if
+    
+    #if $disable_primer_check:
+    -p
+    #end if
+    
+    #if str($added_demultiplex_field):
+    -j $added_demultiplex_field
+    #end if
+    ;
+    rm `basename $mapping_fp .txt`'.html'
+    ;
+    rm overlib.js
+    ;
+    mv `basename $mapping_fp .txt`'.log' $out_log
+    ;
+    mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
   </command>
   <inputs>
     <param name="mapping_fp" label="Metadata mapping file" optional="False" type="data" format="tabular"/>
-    
+  
     <param name="char_replace" value="_" label="Character used to replace invalid characters found in the mapping file. Must be a valid character (alphanumeric, period, or underscore)" optional="False" type="text"/>
     
     <param name="not_barcoded" label="Set if barcodes are not present. BarcodeSequence header still required" selected="False" type="boolean"/>
@@ -56,64 +58,63 @@
     <data format="txt" name="out_log" label="${tool.name} on ${mapping_fp.name}"/>
     <data format="tabular" name="out_txt" label="Corrected ${mapping_fp.name}"/>
   </outputs>
-<help>
-
-Check ID Map checks::
+  <help>
+    Check ID Map checks::
+    
+    1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
+       have valid IUPAC DNA characters, and BarcodeSequence characters
+       are non-degenerate (error)
 
-1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
-   have valid IUPAC DNA characters, and BarcodeSequence characters
-   are non-degenerate (error)
+    2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
+       headers are present (error)
 
-2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
-   headers are present (error)
-
-3. There are not duplicate header fields (error)
-
-4. There are not duplicate barcodes (error)
+    3. There are not duplicate header fields (error)
+    
+    4. There are not duplicate barcodes (error)
 
-5. Barcodes are of the same length.  Suppressed when
-   variable_len_barcode flag is passed (warning)
+    5. Barcodes are of the same length.  Suppressed when
+       variable_len_barcode flag is passed (warning)
 
-6. The headers do not contain invalid characters (alphanumeric and 
-   underscore only) (warning)
+    6. The headers do not contain invalid characters (alphanumeric and 
+       underscore only) (warning)
 
-7. The data fields do not contain invalid characters (alphanumeric, 
-   underscore, space, and +-%./:,; characters) (warning)
+    7. The data fields do not contain invalid characters (alphanumeric, 
+       underscore, space, and +-%./:,; characters) (warning)
 
-8. SampleID fields are MIENS compliant (only alphanumeric
-   and . characters). (warning)
+    8. SampleID fields are MIENS compliant (only alphanumeric
+       and . characters). (warning)
 
-9. There are no duplicates when the primer and variable length 
-   barcodes are appended (error)
+    9. There are no duplicates when the primer and variable length 
+       barcodes are appended (error)
 
-10. There are no duplicates when barcodes and added demultiplex 
-    fields (-j option) are combined (error)
-
-11. Data fields are not found beyond the Description column (warning)
+    10. There are no duplicates when barcodes and added demultiplex 
+       fields (-j option) are combined (error)
 
-Details about the metadata mapping file format can be found here:
-http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files
+    11. Data fields are not found beyond the Description column (warning)
 
-Errors and warnings are saved to a log file.  Errors can be caused
-by problems with the headers, invalid characters in barcodes or
-primers, or by duplications in SampleIDs or barcodes.
+    Details about the metadata mapping file format can be found here:
+    http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files
 
-Warnings can arise from invalid characters and variable length
-barcodes that are not specified with the --variable_len_barcode.
-Warnings will contain a reference to the cell (row,column) that
-the warning arose from.
+    Errors and warnings are saved to a log file.  Errors can be caused
+    by problems with the headers, invalid characters in barcodes or
+    primers, or by duplications in SampleIDs or barcodes.
+    
+    Warnings can arise from invalid characters and variable length
+    barcodes that are not specified with the --variable_len_barcode.
+    Warnings will contain a reference to the cell (row,column) that
+    the warning arose from.
 
-In addition to the log file, a 'corrected_mapping' file will be
-created.  Any invalid characters will be replaced with '.'
-characters in the SampleID fields (to enforce MIENS compliance)
-and text in other data fields will be replaced with the character
-specified by the -c parameter, which is an underscore '_' by
-default.
+    In addition to the log file, a 'corrected_mapping' file will be
+    created.  Any invalid characters will be replaced with '.'
+    characters in the SampleID fields (to enforce MIENS compliance)
+    and text in other data fields will be replaced with the character
+    specified by the -c parameter, which is an underscore '_' by
+    default.
 
-If pooled primers are used, separate with a comma.  For instance,
-a pooled set of three 27f primers (used to increase taxonomic
-coverage) could be specified in the LinkerPrimerSequence fields as
-such:
-AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
-</help>
+    If pooled primers are used, separate with a comma. For instance,
+    a pooled set of three 27f primers (used to increase taxonomic
+    coverage) could be specified in the LinkerPrimerSequence fields as
+    such:
+    AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
+  </help>
 </tool>