<?xml version="1.0" ?>
<tool id="check_id_map" name="Check ID Map" version="1.6.0">
  <description>
    Checks user's metadata mapping file for required data, valid
    format
  </description>
  <requirements>
    <requirement type="package">qiime</requirement>
  </requirements>
  <command>check_id_map.py
  
  -m $mapping_fp

  #if str($char_replace):
  -c $char_replace
  #end if
  
  #if $not_barcoded:
  -b
  #end if
  
  #if $variable_len_barcodes:
  -B
  #end if

  #if $disable_primer_check:
  -p
  #end if

  #if str($added_demultiplex_field):
  -j $added_demultiplex_field
  #end if
  ;
  rm `basename $mapping_fp .txt`'.html'
  ;
  rm overlib.js
  ;
  mv `basename $mapping_fp .txt`'.log' $out_log
  ;
  mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
  </command>
  <inputs>
    <param name="mapping_fp" label="Metadata mapping file" optional="False" type="data" format="tabular"/>
    
    <param name="char_replace" value="_" label="Character used to replace invalid characters found in the mapping file. Must be a valid character (alphanumeric, period, or underscore)" optional="False" type="text"/>
    
    <param name="not_barcoded" label="Set if barcodes are not present. BarcodeSequence header still required" selected="False" type="boolean"/>
    
    <param name="variable_len_barcodes" label="Set if variable length barcodes are present to suppress warnings about barcodes of unequal length"  selected="False" type="boolean"/>
    
    <param name="disable_primer_check" label="Set to disable checks for primers. LinkerPrimerSequence header still required" selected="False" type="boolean"/>
    
    <param name="added_demultiplex_field" label="Use to add a field to use in the mapping file as additional demultiplexing (can be used with or without barcodes).  All combinations of barcodes/primers and the these fields must be unique. The fields must contain values that can be parsed from the fasta labels such as 'plate=R_2008_12_09'.  In this case, 'plate' would be the column header and 'R_2008_12_09' would be the field data (minus quotes) in the mapping file.  To use the run prefix from the fasta label, such as '>FLP3FBN01ELBSX', where 'FLP3FBN01' is generated from the run ID, use '-j run_prefix' and set the run prefix to be used as the data under the column header 'run_prefix'" optional="False" type="text" value=""/>
  </inputs>
  <outputs>
    <data format="txt" name="out_log" label="${tool.name} on ${mapping_fp.name}"/>
    <data format="tabular" name="out_txt" label="Corrected ${mapping_fp.name}"/>
  </outputs>
<help>

Specifically, we check that:

1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
   have valid IUPAC DNA characters, and BarcodeSequence characters
   are non-degenerate (error)

2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
   headers are present (error)

3. There are not duplicate header fields (error)

4. There are not duplicate barcodes (error)

5. Barcodes are of the same length.  Suppressed when
   variable_len_barcode flag is passed (warning)

6. The headers do not contain invalid characters (alphanumeric and 
   underscore only) (warning)

7. The data fields do not contain invalid characters (alphanumeric, 
   underscore, space, and +-%./:,; characters) (warning)

8. SampleID fields are MIENS compliant (only alphanumeric
   and . characters). (warning)

9. There are no duplicates when the primer and variable length 
   barcodes are appended (error)

10. There are no duplicates when barcodes and added demultiplex 
    fields (-j option) are combined (error)

11. Data fields are not found beyond the Description column (warning)

Details about the metadata mapping file format can be found here:
http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files

Errors and warnings are saved to a log file.  Errors can be caused
by problems with the headers, invalid characters in barcodes or
primers, or by duplications in SampleIDs or barcodes.

Warnings can arise from invalid characters and variable length
barcodes that are not specified with the --variable_len_barcode.
Warnings will contain a reference to the cell (row,column) that
the warning arose from.

In addition to the log file, a 'corrected_mapping' file will be
created.  Any invalid characters will be replaced with '.'
characters in the SampleID fields (to enforce MIENS compliance)
and text in other data fields will be replaced with the character
specified by the -c parameter, which is an underscore '_' by
default.

If pooled primers are used, separate with a comma.  For instance,
a pooled set of three 27f primers (used to increase taxonomic
coverage) could be specified in the LinkerPrimerSequence fields as
such:
AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
</help>
</tool>