# HG changeset patch
# User davide-albanese
# Date 1362866488 18000
# Node ID fb797308e55267512e93c291f8d36d23b820bac6
# Parent  27a2d07f4d530da40c65a27ca4ad529616d291d7
Deleted selected files

diff -r 27a2d07f4d53 -r fb797308e552 README.rst
--- a/README.rst	Sat Mar 09 22:58:27 2013 +0100
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-QIIME-1.6.0
-===========
-
-* Check ID Map
-
-Author: Davide Albanese <davide.albanese@gmail.com> - Fondazione Edmud
-Mach, 2012
diff -r 27a2d07f4d53 -r fb797308e552 check_id_map.xml
--- a/check_id_map.xml	Sat Mar 09 22:58:27 2013 +0100
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,120 +0,0 @@
-<!-- Author: Davide Albanese - Fondazione Edmud Mach, 2013 -->
-
-<tool id="check_id_map" name="Check ID Map" version="1.6.0-3">
-  <description>
-    Checks user's metadata mapping file for required data, valid
-    format
-  </description>
-  <requirements>
-    <requirement type="binary">check_id_map.py</requirement>
-  </requirements>
-  <command>
-check_id_map.py
-
--m $mapping_fp
-
-#if str($char_replace):
--c $char_replace
-#end if
-
-#if $not_barcoded:
--b
-#end if
-
-#if $variable_len_barcodes:
--B
-#end if
-
-#if $disable_primer_check:
--p
-#end if
-
-#if str($added_demultiplex_field):
--j $added_demultiplex_field
-#end if
-;
-rm `basename $mapping_fp .txt`'.html'
-;
-rm overlib.js
-;
-mv `basename $mapping_fp .txt`'.log' $out_log
-;
-mv `basename $mapping_fp .txt`'_corrected.txt' $out_txt
-  </command>
-  <inputs>
-    <param name="mapping_fp" label="Metadata mapping file" optional="False" type="data" format="tabular"/>
-    
-    <param name="char_replace" value="_" label="Character used to replace invalid characters found in the mapping file. Must be a valid character (alphanumeric, period, or underscore)" optional="False" type="text"/>
-    
-    <param name="not_barcoded" label="Set if barcodes are not present. BarcodeSequence header still required" selected="False" type="boolean"/>
-    
-    <param name="variable_len_barcodes" label="Set if variable length barcodes are present to suppress warnings about barcodes of unequal length"  selected="False" type="boolean"/>
-    
-    <param name="disable_primer_check" label="Set to disable checks for primers. LinkerPrimerSequence header still required" selected="False" type="boolean"/>
-    
-    <param name="added_demultiplex_field" label="Use to add a field to use in the mapping file as additional demultiplexing (can be used with or without barcodes).  All combinations of barcodes/primers and the these fields must be unique. The fields must contain values that can be parsed from the fasta labels such as 'plate=R_2008_12_09'.  In this case, 'plate' would be the column header and 'R_2008_12_09' would be the field data (minus quotes) in the mapping file.  To use the run prefix from the fasta label, such as '>FLP3FBN01ELBSX', where 'FLP3FBN01' is generated from the run ID, use '-j run_prefix' and set the run prefix to be used as the data under the column header 'run_prefix'" optional="False" type="text" value=""/>
-  </inputs>
-  <outputs>
-    <data format="txt" name="out_log" label="${tool.name} on ${mapping_fp.name}"/>
-    <data format="tabular" name="out_txt" label="Corrected ${mapping_fp.name}"/>
-  </outputs>
-  <help>
-Check ID Map checks:
-
-1. The BarcodeSequence, LinkerPrimerSequences, and ReversePrimer fields 
-   have valid IUPAC DNA characters, and BarcodeSequence characters
-   are non-degenerate (error)
-
-2. The SampleID, BarcodeSequence, LinkerPrimerSequence, and Description
-   headers are present (error)
-
-3. There are not duplicate header fields (error)
-
-4. There are not duplicate barcodes (error)
-
-5. Barcodes are of the same length.  Suppressed when
-   variable_len_barcode flag is passed (warning)
-
-6. The headers do not contain invalid characters (alphanumeric and 
-   underscore only) (warning)
-
-7. The data fields do not contain invalid characters (alphanumeric, 
-   underscore, space, and +-%./:,; characters) (warning)
-
-8. SampleID fields are MIENS compliant (only alphanumeric
-   and . characters). (warning)
-
-9. There are no duplicates when the primer and variable length 
-   barcodes are appended (error)
-
-10. There are no duplicates when barcodes and added demultiplex 
-    fields (-j option) are combined (error)
-
-11. Data fields are not found beyond the Description column (warning)
-
-Details about the metadata mapping file format can be found here:
-http://www.qiime.org/documentation/file_formats.html#metadata-mapping-files
-
-Errors and warnings are saved to a log file.  Errors can be caused
-by problems with the headers, invalid characters in barcodes or
-primers, or by duplications in SampleIDs or barcodes.
-
-Warnings can arise from invalid characters and variable length
-barcodes that are not specified with the --variable_len_barcode.
-Warnings will contain a reference to the cell (row,column) that
-the warning arose from.
-
-In addition to the log file, a 'corrected_mapping' file will be
-created.  Any invalid characters will be replaced with '.'
-characters in the SampleID fields (to enforce MIENS compliance)
-and text in other data fields will be replaced with the character
-specified by the -c parameter, which is an underscore '_' by
-default.
-
-If pooled primers are used, separate with a comma. For instance,
-a pooled set of three 27f primers (used to increase taxonomic
-coverage) could be specified in the LinkerPrimerSequence fields as
-such:
-AGGGTTCGATTCTGGCTCAG,AGAGTTTGATCCTGGCTTAG,AGAATTTGATCTTGGTTCAG
-  </help>
-</tool>