--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/igblastn.xml	Mon Aug 29 05:41:20 2016 -0400
@@ -0,0 +1,98 @@
+<tool id="igblastn" name="igBLASTn" version="0.1.0">
+    <description> </description>
+    <command interpreter="bash">
+		igblast/igblast.sh $input $species $locus $output
+    </command>
+    <inputs>
+        <param name="input" type="data" format="fasta" label="Fasta file"/>
+        <param name="species" type="select" label="Species">
+					<option value="human">Homo sapiens</option>
+					<option value="mouse">Mus musculus</option>
+					<option value="rat">Rattus norvegicus</option>
+					<option value="rabbit">Oryctolagus cuniculus</option>
+					<option value="rhesus_monkey">Macaca mulatta</option>
+				</param>
+        <param name="locus" type="select" label="Locus">
+					<option value="TRA">TRA</option>
+					<option value="TRB">TRB</option>
+					<option value="TRG">TRG</option>
+					<option value="TRD">TRD</option>	
+					<option value="IGH">IGH</option>
+					<option value="IGK">IGK</option>
+					<option value="IGL">IGL</option>					
+				</param>
+    </inputs>
+    <outputs>
+        <data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/>
+	<!--<data name="log" format="text" label="log"/>-->
+    </outputs>
+	<requirements>
+		<requirement type="package" version="0.6">igblastwrp</requirement>
+	</requirements>
+    <help>
+============
+iReport
+============
+
+This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing.
+
+**NOTE**
+
+.. class:: warningmark
+
+- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use.
+
+**USAGE**
+
+.. class:: infomark
+
+- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers.
+
+
+**INPUT**
+
+This tool accepts FASTA files as input:
+
+::
+
+		>lcl|FLN1FA002RWEZA.1| 
+		ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
+		tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
+		gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
+		cag
+		>lcl|FLN1FA001BLION.1| 
+		aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
+		taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
+		cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name     | Column contents                              |
++-----------------+----------------------------------------------+
+| ID              | The Sequence ID provided by the sequencer.   |
++-----------------+----------------------------------------------+
+| VDJ Frame       | In-frame/Out-frame                           |
++-----------------+----------------------------------------------+
+| Top V Gene      | The best matching V gene found.              |
++-----------------+----------------------------------------------+
+| Top D Gene      | The best matching D gene found.              |
++-----------------+----------------------------------------------+
+| Top J Gene      | The best matching J gene found.              |
++-----------------+----------------------------------------------+
+| CDR3 Seq        | The CDR3 region.                             |
++-----------------+----------------------------------------------+
+| CDR3 Length     | The length of the CDR3 region.               |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA    | The CDR3 sequence region.                    |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region.      |
++-----------------+----------------------------------------------+
+| Functionality   | If sequence is productive/unproductive       |
++-----------------+----------------------------------------------+
+
+
+    </help>
+</tool>