<tool id="igblastn" name="igBLASTn" version="0.1.0">
    <description> </description>
    <command interpreter="bash">
		igblast/igblast.sh $input $species $locus $output
	</command>
	<inputs>
		<param name="input" type="data" format="fasta" label="Fasta file"/>
		<param name="species" type="select" label="Species">
			<option value="human">Homo sapiens</option>
			<option value="mouse">Mus musculus</option>
			<option value="rat">Rattus norvegicus</option>
			<option value="rabbit">Oryctolagus cuniculus</option>
			<option value="rhesus_monkey">Macaca mulatta</option>
			<option value="BosTaurus">BosTaurus</option>
			<option value="CamelusDromedarius">CamelusDromedarius</option>
			<option value="CanisLupusFamiliaris">CanisLupusFamiliaris</option>
			<option value="DanioRerio">DanioRerio</option>
			<option value="MusSpretus">MusSpretus</option>
			<option value="OncorhynchusMykiss">OncorhynchusMykiss</option>
			<option value="SusScrofa">SusScrofa</option>
			<option value="GallusGallus">GallusGallus</option>
			<option value="AnasPlatyrhynchos">AnasPlatyrhynchos</option>
				</param>
		<param name="locus" type="select" label="Locus">
			<option value="TRA">TRA</option>
			<option value="TRB">TRB</option>
			<option value="TRG">TRG</option>
			<option value="TRD">TRD</option>
			<option value="IGH">IGH</option>
			<option value="IGK">IGK</option>
			<option value="IGL">IGL</option>
		</param>
	</inputs>
	<outputs>
		<data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/>
	<!--<data name="log" format="text" label="log"/>-->
	</outputs>
	<requirements>
		<requirement type="package" version="0.6">igblastwrp</requirement>
	</requirements>
	<help>
============
iReport
============

This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing.

**NOTE**

.. class:: warningmark

- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use.

**USAGE**

.. class:: infomark

- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers.


**INPUT**

This tool accepts FASTA files as input:

::

		>lcl|FLN1FA002RWEZA.1| 
		ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
		tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
		gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
		cag
		>lcl|FLN1FA001BLION.1| 
		aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
		taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
		cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag

**OUTPUT**

The following data is used for ARGalaxy

+-----------------+----------------------------------------------+
| Column name     | Column contents                              |
+-----------------+----------------------------------------------+
| ID              | The Sequence ID provided by the sequencer.   |
+-----------------+----------------------------------------------+
| VDJ Frame       | In-frame/Out-frame                           |
+-----------------+----------------------------------------------+
| Top V Gene      | The best matching V gene found.              |
+-----------------+----------------------------------------------+
| Top D Gene      | The best matching D gene found.              |
+-----------------+----------------------------------------------+
| Top J Gene      | The best matching J gene found.              |
+-----------------+----------------------------------------------+
| CDR3 Seq        | The CDR3 region.                             |
+-----------------+----------------------------------------------+
| CDR3 Length     | The length of the CDR3 region.               |
+-----------------+----------------------------------------------+
| CDR3 Seq DNA    | The CDR3 sequence region.                    |
+-----------------+----------------------------------------------+
| CDR3 Length DNA | The length of the CDR3 sequence region.      |
+-----------------+----------------------------------------------+
| Functionality   | If sequence is productive/unproductive       |
+-----------------+----------------------------------------------+


    </help>
</tool>