Mercurial > repos > davidvanzessen > argalaxy_tools

changeset 10:768e258f8dba draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author davidvanzessen
date Mon, 19 Dec 2016 09:37:34 -0500
parents efa1f5a17b6e
children 607f176350bf
files experimental_design.xml igblastn.xml igparse.xml imgt_loader.xml report_clonality_igg.xml
diffstat 5 files changed, 424 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/experimental_design.xml	Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,57 @@
+<tool id="experimentaldesign_igg" name="ExperimentalDesign" version="1.0">
+	<description> </description>
+	<command interpreter="bash">
+		experimental_design/experimental_design.sh 
+		#for $i, $f in enumerate($patients)
+            "$f.id"
+            #for $j, $g in enumerate($f.samples)
+            	${g.sample}
+            #end for
+		#end for
+		$out_file
+	</command>
+	<inputs>
+		<repeat name="patients" title="Patient" min="1" default="1">
+            <repeat name="samples" title="Sample" min="1" default="1">
+                <param name="sample" format="tabular" type="data" label="Sample to Process" />
+            </repeat>
+			<param name="id" type="text" label="ID" />
+		</repeat>
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file"/>
+	</outputs>
+	<help>
+Takes the ARGalaxy proprietary format and merges several samples and/or patients together.
+	</help>
+ <citations>
+    <!-- Example of annotating a citation using a DOI. -->
+    <citation type="doi">10.1093/bioinformatics/btq281</citation>
+
+    <!-- Example of annotating a citation using a BibTex entry. -->
+    <citation type="bibtex">@ARTICLE{Kim07aninterior-point,
+    author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky},
+    title = {An interior-point method for large-scale l1-regularized logistic regression},
+    journal = {Journal of Machine Learning Research},
+    year = {2007},
+    volume = {8},
+    pages = {1519-1555}
+    }</citation>
+  </citations>
+  <tests>
+    <test>
+      <param name="input" value="1.bed"/>
+      <param name="column" value="1"/>
+      <param name="order" value="ASC"/>
+      <param name="style" value="num"/>
+      <output name="out_file1" file="sort1_num.bed"/>
+    </test>
+    <test>
+      <param name="input" value="7.bed"/>
+      <param name="column" value="1"/>
+      <param name="order" value="ASC"/>
+      <param name="style" value="alpha"/>
+      <output name="out_file1" file="sort1_alpha.bed"/>
+    </test>
+  </tests>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/igblastn.xml	Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,107 @@
+<tool id="igblastn" name="igBLASTn" version="0.1.0">
+    <description> </description>
+    <command interpreter="bash">
+		igblast/igblast.sh $input $species $locus $output
+	</command>
+	<inputs>
+		<param name="input" type="data" format="fasta" label="Fasta file"/>
+		<param name="species" type="select" label="Species">
+			<option value="human">Homo sapiens</option>
+			<option value="mouse">Mus musculus</option>
+			<option value="rat">Rattus norvegicus</option>
+			<option value="rabbit">Oryctolagus cuniculus</option>
+			<option value="rhesus_monkey">Macaca mulatta</option>
+			<option value="BosTaurus">BosTaurus</option>
+			<option value="CamelusDromedarius">CamelusDromedarius</option>
+			<option value="CanisLupusFamiliaris">CanisLupusFamiliaris</option>
+			<option value="DanioRerio">DanioRerio</option>
+			<option value="MusSpretus">MusSpretus</option>
+			<option value="OncorhynchusMykiss">OncorhynchusMykiss</option>
+			<option value="SusScrofa">SusScrofa</option>
+			<option value="GallusGallus">GallusGallus</option>
+			<option value="AnasPlatyrhynchos">AnasPlatyrhynchos</option>
+				</param>
+		<param name="locus" type="select" label="Locus">
+			<option value="TRA">TRA</option>
+			<option value="TRB">TRB</option>
+			<option value="TRG">TRG</option>
+			<option value="TRD">TRD</option>
+			<option value="IGH">IGH</option>
+			<option value="IGK">IGK</option>
+			<option value="IGL">IGL</option>
+		</param>
+	</inputs>
+	<outputs>
+		<data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/>
+	<!--<data name="log" format="text" label="log"/>-->
+	</outputs>
+	<requirements>
+		<requirement type="package" version="0.6">igblastwrp</requirement>
+	</requirements>
+	<help>
+============
+iReport
+============
+
+This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing.
+
+**NOTE**
+
+.. class:: warningmark
+
+- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use.
+
+**USAGE**
+
+.. class:: infomark
+
+- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers.
+
+
+**INPUT**
+
+This tool accepts FASTA files as input:
+
+::
+
+		>lcl|FLN1FA002RWEZA.1| 
+		ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
+		tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
+		gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
+		cag
+		>lcl|FLN1FA001BLION.1| 
+		aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
+		taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
+		cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name     | Column contents                              |
++-----------------+----------------------------------------------+
+| ID              | The Sequence ID provided by the sequencer.   |
++-----------------+----------------------------------------------+
+| VDJ Frame       | In-frame/Out-frame                           |
++-----------------+----------------------------------------------+
+| Top V Gene      | The best matching V gene found.              |
++-----------------+----------------------------------------------+
+| Top D Gene      | The best matching D gene found.              |
++-----------------+----------------------------------------------+
+| Top J Gene      | The best matching J gene found.              |
++-----------------+----------------------------------------------+
+| CDR3 Seq        | The CDR3 region.                             |
++-----------------+----------------------------------------------+
+| CDR3 Length     | The length of the CDR3 region.               |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA    | The CDR3 sequence region.                    |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region.      |
++-----------------+----------------------------------------------+
+| Functionality   | If sequence is productive/unproductive       |
++-----------------+----------------------------------------------+
+
+
+    </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/igparse.xml	Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,15 @@
+<tool id="igblastparser_igg" name="igBLASTparser" version="0.2.0">
+	<description> </description>
+	<command interpreter="perl">
+		igblastparser/igparse.pl $input 0 2>/dev/null | grep -v "D:" | cut -f2- > $output
+	</command>
+	<inputs>
+		<param name="input" type="data" format="text" label="igBLASTn report"/>
+	</inputs>
+	<outputs>
+		<data name="output" format="tabular" label="${input.name}-parsed" />
+	</outputs>
+	<help>
+		Step 2 of the Immune Repertoire tools, extracts the relevant information needed from the reports generated by igblast (Step 1)
+	</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/imgt_loader.xml	Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,48 @@
+<tool id="imgt_loader_igg" name="IMGT Loader" version="1.0">
+	<description> </description>
+	<command interpreter="bash">
+		imgt_loader/imgt_loader.sh $in_file $out_file "tmp"
+	</command>
+	<inputs>
+        <param name="in_file" type="data" label="Archive with files" />
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file" label="IMGT Loader on ${in_file.name}"/>
+	</outputs>
+	<help>
+**INPUT**
+
+This tool accepts an IMGT/HIGHV-QUEST ZIP file
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name     | Column contents                              |
++-----------------+----------------------------------------------+
+| ID              | The Sequence ID provided by the sequencer.   |
++-----------------+----------------------------------------------+
+| VDJ Frame       | In-frame/Out-frame                           |
++-----------------+----------------------------------------------+
+| Top V Gene      | The best matching V gene found.              |
++-----------------+----------------------------------------------+
+| Top D Gene      | The best matching D gene found.              |
++-----------------+----------------------------------------------+
+| Top J Gene      | The best matching J gene found.              |
++-----------------+----------------------------------------------+
+| CDR3 Seq        | The CDR3 region.                             |
++-----------------+----------------------------------------------+
+| CDR3 Length     | The length of the CDR3 region.               |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA    | The CDR3 sequence region.                    |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region.      |
++-----------------+----------------------------------------------+
+| Functionality   | If sequence is productive/unproductive       |
++-----------------+----------------------------------------------+
+
+
+	</help>
+
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/report_clonality_igg.xml	Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,197 @@
+<tool id="report_clonality_igg" name="Report Clonality" version="1.0">
+	<description> </description>
+	<command interpreter="bash">
+#if $gene_selection.source == "imgtdb"		
+	report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "${gene_selection.species}" "${gene_selection.locus}" $filterproductive $clonality_method
+#else
+	report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method
+#end if
+	</command>
+	<inputs>
+		<param name="in_file" format="tabular" type="data" label="Data to Process" />
+		<param name="clonaltype" type="select" label="Clonal Type Definition (Needed for clonality calculation)">
+			<option value="none">Don't remove duplicates based on clonaltype</option>
+			<option value="Top.V.Gene,CDR3.Seq">Top.V.Gene, CDR3 (AA)</option>
+			<option value="Top.V.Gene,CDR3.Seq.DNA">Top.V.Gene, CDR3 (nt)</option>
+			<option value="Top.V.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.J.Gene, CDR3 (AA)</option>
+			<option value="Top.V.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.J.Gene, CDR3 (nt)</option>
+			<option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (nt)</option>
+			<option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (AA)</option>
+		</param>
+		
+		<conditional name="gene_selection" >
+			<param name="source" type="select" label="Gene reference" help="" >
+					<option value="imgtdb" selected="true">IMGT-DB</option>
+					<option value="custom">User defined</option>
+			</param>
+			<when value="imgtdb">
+				<param name="species" type="select" label="Species">
+					<option value="Homo sapiens functional">Homo sapiens functional</option>
+					<option value="Homo sapiens">Homo sapiens</option>
+					<option value="Homo sapiens non-functional">Homo sapiens non-functional</option>
+					<option value="Bos taurus">Bos taurus</option>
+					<option value="Bos taurus functional">Bos taurus functional</option>
+					<option value="Bos taurus non-functional">Bos taurus non-functional</option>
+					<option value="Camelus dromedarius">Camelus dromedarius</option>
+					<option value="Camelus dromedarius functional">Camelus dromedarius functional</option>
+					<option value="Camelus dromedarius non-functional">Camelus dromedarius non-functional</option>
+					<option value="Canis lupus familiaris">Canis lupus familiaris</option>
+					<option value="Canis lupus familiaris functional">Canis lupus familiaris functional</option>
+					<option value="Canis lupus familiaris non-functional">Canis lupus familiaris non-functional</option>
+					<option value="Danio rerio">Danio rerio</option>
+					<option value="Danio rerio functional">Danio rerio functional</option>
+					<option value="Danio rerio non-functional">Danio rerio non-functional</option>
+					<option value="Macaca mulatta">Macaca mulatta</option>
+					<option value="Macaca mulatta functional">Macaca mulatta functional</option>
+					<option value="Macaca mulatta non-functional">Macaca mulatta non-functional</option>
+					<option value="Mus musculus">Mus musculus</option>
+					<option value="Mus musculus functional">Mus musculus functional</option>
+					<option value="Mus musculus non-functional">Mus musculus non-functional</option>
+					<option value="Mus spretus">Mus spretus</option>
+					<option value="Mus spretus functional">Mus spretus functional</option>
+					<option value="Mus spretus non-functional">Mus spretus non-functional</option>
+					<option value="Oncorhynchus mykiss">Oncorhynchus mykiss</option>
+					<option value="Oncorhynchus mykiss functional">Oncorhynchus mykiss functional</option>
+					<option value="Oncorhynchus mykiss non-functional">Oncorhynchus mykiss non-functional</option>
+					<option value="Ornithorhynchus anatinus">Ornithorhynchus anatinus</option>
+					<option value="Ornithorhynchus anatinus functional">Ornithorhynchus anatinus functional</option>
+					<option value="Ornithorhynchus anatinus non-functional">Ornithorhynchus anatinus non-functional</option>
+					<option value="Oryctolagus cuniculus">Oryctolagus cuniculus</option>
+					<option value="Oryctolagus cuniculus functional">Oryctolagus cuniculus functional</option>
+					<option value="Oryctolagus cuniculus non-functional">Oryctolagus cuniculus non-functional</option>
+					<option value="Rattus norvegicus">Rattus norvegicus</option>
+					<option value="Rattus norvegicus functional">Rattus norvegicus functional</option>
+					<option value="Rattus norvegicus non-functional">Rattus norvegicus non-functional</option>
+					<option value="Sus scrofa">Sus scrofa</option>
+					<option value="Sus scrofa functional">Sus scrofa functional</option>
+					<option value="Sus scrofa non-functional">Sus scrofa non-functional</option>
+				</param>
+			
+				<param name="locus" type="select" label="Locus">
+					<option value="TRA">TRA</option>
+					<option value="TRD">TRD</option>
+					<option value="TRG">TRG</option>
+					<option value="TRB">TRB</option>
+					<option value="IGH">IGH</option>
+					<option value="IGI">IGI</option>
+					<option value="IGK">IGK</option>
+					<option value="IGL">IGL</option>
+				</param>
+			</when>
+			<when value="custom">
+				<param name="species" type="hidden" value="custom" size="50" />
+				<param name="vgenes" type="text" label="V Genes, add the custom genes comma seperated, no spaces" size="100" />
+				<param name="dgenes" type="text" label="D Genes" size="100" />
+				<param name="jgenes" type="text" label="J Genes" size="100" />
+			</when>
+		</conditional>
+		
+		<param name="filterproductive" type="select" label="Remove the unproductive sequences from graphs ">
+			<option value="yes">Yes</option>
+			<option value="no">No</option>
+		</param>
+		
+		<param name="clonality_method" type="select" label="Old clonality algorithm or the newer R package">
+			<option value="old">Old</option>
+			<option value="boyd">R Package</option>
+		</param>
+		
+	</inputs>
+	<outputs>
+		<data format="html" name="out_file" />
+	</outputs>
+	<requirements>
+		<requirement type="package" version="3.3">weblogo</requirement>
+		<!--<requirement type="package" version="0.20">circostools</requirement>-->
+	</requirements>
+	<help>		
+**INPUT**
+
+One or more ARGalaxy proprietary format files combined with the ARGalaxy Experimental Design tool
+
+
+.. class:: warningmark
+
+Custom gene ordering based on position on genome: 
+
+**Human**
+
+IGH::
+
+    V:
+    IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1
+    D:
+    IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27
+    J:
+    IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6
+
+
+IGK::
+
+    V:
+    IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1
+    J:
+    IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5
+
+
+IGL::
+
+    V:
+    IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1
+    J:
+    IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7
+
+
+TRB::
+
+    V:
+    TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30
+    D:
+    TRBD1,TRBD2
+    J:
+    TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7
+
+
+TRA::
+
+    V:
+    TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41
+    J:
+    TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3
+
+
+TRG::
+
+    V:
+    TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2
+    J:
+    TRGJ2,TRGJP2,TRGJ1,TRGJP1
+
+
+TRD::
+
+    V:
+    TRDV1,TRDV2,TRDV3
+    D:
+    TRDD1,TRDD2,TRDD3
+    J:
+    TRDJ1,TRDJ4,TRDJ2,TRDJ3
+
+
+**Mouse**
+
+TRB::
+
+    V:
+    TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31
+    D:
+    TRBD1,TRBD2
+    J:
+    TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7
+    
+
+**OUTPUT**
+
+It generates the following result:
+	</help>
+</tool>