Mercurial > repos > davidvanzessen > argalaxy_tools
changeset 8:8cbc1a8d27ae draft
Uploaded
| author | davidvanzessen |
|---|---|
| date | Mon, 19 Dec 2016 08:50:31 -0500 |
| parents | 54f6756bacb1 |
| children | efa1f5a17b6e |
| files | experimental_design.xml igblast/igblast.sh igblastn.xml igparse.xml imgt_loader.xml report_clonality/RScript.r report_clonality/r_wrapper.sh report_clonality_igg.xml |
| diffstat | 8 files changed, 65 insertions(+), 446 deletions(-) [+] |
line wrap: on
line diff
--- a/experimental_design.xml Fri Dec 16 09:01:40 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,57 +0,0 @@ -<tool id="experimentaldesign_igg" name="ExperimentalDesign" version="1.0"> - <description> </description> - <command interpreter="bash"> - experimental_design/experimental_design.sh - #for $i, $f in enumerate($patients) - "$f.id" - #for $j, $g in enumerate($f.samples) - ${g.sample} - #end for - #end for - $out_file - </command> - <inputs> - <repeat name="patients" title="Patient" min="1" default="1"> - <repeat name="samples" title="Sample" min="1" default="1"> - <param name="sample" format="tabular" type="data" label="Sample to Process" /> - </repeat> - <param name="id" type="text" label="ID" /> - </repeat> - </inputs> - <outputs> - <data format="tabular" name="out_file"/> - </outputs> - <help> -Takes the ARGalaxy proprietary format and merges several samples and/or patients together. - </help> - <citations> - <!-- Example of annotating a citation using a DOI. --> - <citation type="doi">10.1093/bioinformatics/btq281</citation> - - <!-- Example of annotating a citation using a BibTex entry. --> - <citation type="bibtex">@ARTICLE{Kim07aninterior-point, - author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky}, - title = {An interior-point method for large-scale l1-regularized logistic regression}, - journal = {Journal of Machine Learning Research}, - year = {2007}, - volume = {8}, - pages = {1519-1555} - }</citation> - </citations> - <tests> - <test> - <param name="input" value="1.bed"/> - <param name="column" value="1"/> - <param name="order" value="ASC"/> - <param name="style" value="num"/> - <output name="out_file1" file="sort1_num.bed"/> - </test> - <test> - <param name="input" value="7.bed"/> - <param name="column" value="1"/> - <param name="order" value="ASC"/> - <param name="style" value="alpha"/> - <output name="out_file1" file="sort1_alpha.bed"/> - </test> - </tests> -</tool>
--- a/igblast/igblast.sh Fri Dec 16 09:01:40 2016 -0500 +++ b/igblast/igblast.sh Mon Dec 19 08:50:31 2016 -0500 @@ -15,9 +15,15 @@ species="${speciesdict[$species]}" +if [ "$species" == "" ] +then + >&2 echo "Species not possible with igBLASTn, use IMGT" + exit 1 +fi + echo "$input $species $locus $output" -java -Xmx64G -jar $IGBLASTWRP/igblastwrp.jar -p 4 -S $species -R $locus ${input} $PWD/blasted_output 2>&1 +java -Xmx16G -jar $IGBLASTWRP/igblastwrp.jar -p 4 -S $species -R $locus ${input} $PWD/blasted_output 2>&1 #java -Xmx64G -jar $dir/igblastwrp.jar -p 4 -S $species -R $locus ${input} $PWD/blasted_output 2>&1 #java -Xmx64G -jar $dir/migmap-1.0.1.jar -p 4 -S "$species" -R $locus ${input} $PWD/blasted_output 2>&1
--- a/igblastn.xml Fri Dec 16 09:01:40 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,107 +0,0 @@ -<tool id="igblastn" name="igBLASTn" version="0.1.0"> - <description> </description> - <command interpreter="bash"> - igblast/igblast.sh $input $species $locus $output - </command> - <inputs> - <param name="input" type="data" format="fasta" label="Fasta file"/> - <param name="species" type="select" label="Species"> - <option value="human">Homo sapiens</option> - <option value="mouse">Mus musculus</option> - <option value="rat">Rattus norvegicus</option> - <option value="rabbit">Oryctolagus cuniculus</option> - <option value="rhesus_monkey">Macaca mulatta</option> - <option value="BosTaurus">BosTaurus</option> - <option value="CamelusDromedarius">CamelusDromedarius</option> - <option value="CanisLupusFamiliaris">CanisLupusFamiliaris</option> - <option value="DanioRerio">DanioRerio</option> - <option value="MusSpretus">MusSpretus</option> - <option value="OncorhynchusMykiss">OncorhynchusMykiss</option> - <option value="SusScrofa">SusScrofa</option> - <option value="GallusGallus">GallusGallus</option> - <option value="AnasPlatyrhynchos">AnasPlatyrhynchos</option> - </param> - <param name="locus" type="select" label="Locus"> - <option value="TRA">TRA</option> - <option value="TRB">TRB</option> - <option value="TRG">TRG</option> - <option value="TRD">TRD</option> - <option value="IGH">IGH</option> - <option value="IGK">IGK</option> - <option value="IGL">IGL</option> - </param> - </inputs> - <outputs> - <data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/> - <!--<data name="log" format="text" label="log"/>--> - </outputs> - <requirements> - <requirement type="package" version="0.6">igblastwrp</requirement> - </requirements> - <help> -============ -iReport -============ - -This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing. - -**NOTE** - -.. class:: warningmark - -- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use. - -**USAGE** - -.. class:: infomark - -- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers. - - -**INPUT** - -This tool accepts FASTA files as input: - -:: - - >lcl|FLN1FA002RWEZA.1| - ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc - tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc - gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct - cag - >lcl|FLN1FA001BLION.1| - aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat - taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg - cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag - -**OUTPUT** - -The following data is used for ARGalaxy - -+-----------------+----------------------------------------------+ -| Column name | Column contents | -+-----------------+----------------------------------------------+ -| ID | The Sequence ID provided by the sequencer. | -+-----------------+----------------------------------------------+ -| VDJ Frame | In-frame/Out-frame | -+-----------------+----------------------------------------------+ -| Top V Gene | The best matching V gene found. | -+-----------------+----------------------------------------------+ -| Top D Gene | The best matching D gene found. | -+-----------------+----------------------------------------------+ -| Top J Gene | The best matching J gene found. | -+-----------------+----------------------------------------------+ -| CDR3 Seq | The CDR3 region. | -+-----------------+----------------------------------------------+ -| CDR3 Length | The length of the CDR3 region. | -+-----------------+----------------------------------------------+ -| CDR3 Seq DNA | The CDR3 sequence region. | -+-----------------+----------------------------------------------+ -| CDR3 Length DNA | The length of the CDR3 sequence region. | -+-----------------+----------------------------------------------+ -| Functionality | If sequence is productive/unproductive | -+-----------------+----------------------------------------------+ - - - </help> -</tool>
--- a/igparse.xml Fri Dec 16 09:01:40 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,15 +0,0 @@ -<tool id="igblastparser_igg" name="igBLASTparser" version="0.2.0"> - <description> </description> - <command interpreter="perl"> - igblastparser/igparse.pl $input 0 2>/dev/null | grep -v "D:" | cut -f2- > $output - </command> - <inputs> - <param name="input" type="data" format="text" label="igBLASTn report"/> - </inputs> - <outputs> - <data name="output" format="tabular" label="${input.name}-parsed" /> - </outputs> - <help> - Step 2 of the Immune Repertoire tools, extracts the relevant information needed from the reports generated by igblast (Step 1) - </help> -</tool>
--- a/imgt_loader.xml Fri Dec 16 09:01:40 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,48 +0,0 @@ -<tool id="imgt_loader_igg" name="IMGT Loader" version="1.0"> - <description> </description> - <command interpreter="bash"> - imgt_loader/imgt_loader.sh $in_file $out_file "tmp" - </command> - <inputs> - <param name="in_file" type="data" label="Archive with files" /> - </inputs> - <outputs> - <data format="tabular" name="out_file" label="IMGT Loader on ${in_file.name}"/> - </outputs> - <help> -**INPUT** - -This tool accepts an IMGT/HIGHV-QUEST ZIP file - -**OUTPUT** - -The following data is used for ARGalaxy - -+-----------------+----------------------------------------------+ -| Column name | Column contents | -+-----------------+----------------------------------------------+ -| ID | The Sequence ID provided by the sequencer. | -+-----------------+----------------------------------------------+ -| VDJ Frame | In-frame/Out-frame | -+-----------------+----------------------------------------------+ -| Top V Gene | The best matching V gene found. | -+-----------------+----------------------------------------------+ -| Top D Gene | The best matching D gene found. | -+-----------------+----------------------------------------------+ -| Top J Gene | The best matching J gene found. | -+-----------------+----------------------------------------------+ -| CDR3 Seq | The CDR3 region. | -+-----------------+----------------------------------------------+ -| CDR3 Length | The length of the CDR3 region. | -+-----------------+----------------------------------------------+ -| CDR3 Seq DNA | The CDR3 sequence region. | -+-----------------+----------------------------------------------+ -| CDR3 Length DNA | The length of the CDR3 sequence region. | -+-----------------+----------------------------------------------+ -| Functionality | If sequence is productive/unproductive | -+-----------------+----------------------------------------------+ - - - </help> - -</tool>
--- a/report_clonality/RScript.r Fri Dec 16 09:01:40 2016 -0500 +++ b/report_clonality/RScript.r Mon Dec 19 08:50:31 2016 -0500 @@ -135,6 +135,20 @@ } } +#make a names list with sample -> color +naive.colors = c('blue4', 'darkred', 'olivedrab3', 'red', 'gray74', 'darkviolet', 'lightblue1', 'gold', 'chartreuse2', 'pink', 'Paleturquoise3', 'Chocolate1', 'Yellow', 'Deeppink3', 'Mediumorchid1', 'Darkgreen', 'Blue', 'Gray36', 'Hotpink', 'Yellow4') +unique.samples = unique(PRODF$Sample) + +if(length(unique.samples) <= length(naive.colors)){ + sample.colors = naive.colors[1:length(unique.samples)] +} else { + sample.colors = rainbow(length(unique.samples)) +} + +names(sample.colors) = unique.samples + +print("Sample.colors") +print(sample.colors) #write the complete dataset that is left over, will be the input if 'none' for clonaltype and 'no' for filterproductive @@ -275,7 +289,8 @@ pV = ggplot(PRODFV) pV = pV + geom_bar( aes( x=factor(reorder(Top.V.Gene, chr.orderV)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) -pV = pV + xlab("Summary of V gene") + ylab("Frequency") + ggtitle("Relative frequency of V gene usage") +pV = pV + xlab("Summary of V gene") + ylab("Frequency") + ggtitle("Relative frequency of V gene usage") + scale_fill_manual(values=sample.colors) +pV = pV + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) write.table(x=PRODFV, file="VFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) png("VPlot.png",width = 1280, height = 720) @@ -285,7 +300,8 @@ if(useD){ pD = ggplot(PRODFD) pD = pD + geom_bar( aes( x=factor(reorder(Top.D.Gene, chr.orderD)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) - pD = pD + xlab("Summary of D gene") + ylab("Frequency") + ggtitle("Relative frequency of D gene usage") + pD = pD + xlab("Summary of D gene") + ylab("Frequency") + ggtitle("Relative frequency of D gene usage") + scale_fill_manual(values=sample.colors) + pD = pD + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) write.table(x=PRODFD, file="DFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) png("DPlot.png",width = 800, height = 600) @@ -295,16 +311,8 @@ pJ = ggplot(PRODFJ) pJ = pJ + geom_bar( aes( x=factor(reorder(Top.J.Gene, chr.orderJ)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) -pJ = pJ + xlab("Summary of J gene") + ylab("Frequency") + ggtitle("Relative frequency of J gene usage") -write.table(x=PRODFJ, file="JFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) - -png("JPlot.png",width = 800, height = 600) -pJ -dev.off(); - -pJ = ggplot(PRODFJ) -pJ = pJ + geom_bar( aes( x=factor(reorder(Top.J.Gene, chr.orderJ)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) -pJ = pJ + xlab("Summary of J gene") + ylab("Frequency") + ggtitle("Relative frequency of J gene usage") +pJ = pJ + xlab("Summary of J gene") + ylab("Frequency") + ggtitle("Relative frequency of J gene usage") + scale_fill_manual(values=sample.colors) +pJ = pJ + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) write.table(x=PRODFJ, file="JFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) png("JPlot.png",width = 800, height = 600) @@ -324,7 +332,9 @@ VPlot = ggplot(VGenes) VPlot = VPlot + geom_bar(aes( x = Top.V.Gene, y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + ggtitle("Distribution of V gene families") + - ylab("Percentage of sequences") + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) png("VFPlot.png") VPlot dev.off(); @@ -340,7 +350,9 @@ DPlot = ggplot(DGenes) DPlot = DPlot + geom_bar(aes( x = Top.D.Gene, y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + ggtitle("Distribution of D gene families") + - ylab("Percentage of sequences") + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) png("DFPlot.png") print(DPlot) dev.off(); @@ -359,7 +371,9 @@ CDR3LengthPlot = CDR3LengthPlot + geom_bar(aes( x = CDR3.Length.DNA, y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + ggtitle("Length distribution of CDR3") + xlab("CDR3 Length") + - ylab("Percentage of sequences") + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) png("CDR3LengthPlot.png",width = 1280, height = 720) CDR3LengthPlot dev.off() @@ -786,16 +800,21 @@ # ---------------------- D reading frame ---------------------- -D.REGION.reading.frame = PRODF$D.REGION.reading.frame +D.REGION.reading.frame = PRODF[,c("Sample", "D.REGION.reading.frame")] -D.REGION.reading.frame[is.na(D.REGION.reading.frame)] = "No D" +chck = is.na(D.REGION.reading.frame$D.REGION.reading.frame) +if(any(chck)){ + D.REGION.reading.frame[chck,"D.REGION.reading.frame"] = "No D" +} -D.REGION.reading.frame = data.frame(table(D.REGION.reading.frame)) +D.REGION.reading.frame = data.frame(data.table(D.REGION.reading.frame)[, list(Freq=.N), by=c("Sample", "D.REGION.reading.frame")]) write.table(D.REGION.reading.frame, "DReadingFrame.csv" , sep="\t",quote=F,row.names=F,col.names=T) D.REGION.reading.frame = ggplot(D.REGION.reading.frame) -D.REGION.reading.frame = D.REGION.reading.frame + geom_bar(aes( x = D.REGION.reading.frame, y = Freq), stat='identity', position='dodge' ) + ggtitle("D reading frame") + xlab("Frequency") + ylab("Frame") +D.REGION.reading.frame = D.REGION.reading.frame + geom_bar(aes( x = D.REGION.reading.frame, y = Freq, fill=Sample), stat='identity', position='dodge' ) + ggtitle("D reading frame") + xlab("Frequency") + ylab("Frame") +D.REGION.reading.frame = D.REGION.reading.frame + scale_fill_manual(values=sample.colors) +D.REGION.reading.frame = D.REGION.reading.frame + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) png("DReadingFrame.png") D.REGION.reading.frame @@ -834,11 +853,16 @@ AAfreqplot = AAfreqplot + annotate("rect", xmin = 3.5, xmax = 4.5, ymin = 0, ymax = Inf, fill = "blue", alpha = 0.2) AAfreqplot = AAfreqplot + annotate("rect", xmin = 5.5, xmax = 6.5, ymin = 0, ymax = Inf, fill = "blue", alpha = 0.2) AAfreqplot = AAfreqplot + annotate("rect", xmin = 6.5, xmax = 7.5, ymin = 0, ymax = Inf, fill = "red", alpha = 0.2) -AAfreqplot = AAfreqplot + ggtitle("Amino Acid Composition in the CDR3") + xlab("Amino Acid, from Hydrophilic (left) to Hydrophobic (right)") + ylab("Percentage") +AAfreqplot = AAfreqplot + ggtitle("Amino Acid Composition in the CDR3") + xlab("Amino Acid, from Hydrophilic (left) to Hydrophobic (right)") + ylab("Percentage") + scale_fill_manual(values=sample.colors) +AAfreqplot = AAfreqplot + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) png("AAComposition.png",width = 1280, height = 720) AAfreqplot dev.off() write.table(AAfreq, "AAComposition.csv" , sep=",",quote=F,na="-",row.names=F,col.names=T) +# ---------------------- AA median CDR3 length ---------------------- +median.aa.l = data.frame(data.table(PRODF)[, list(median=as.double(median(.SD$CDR3.Length.DNA))), by=c("Sample")]) +write.table(median.aa.l, "AAMedianBySample.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) +
--- a/report_clonality/r_wrapper.sh Fri Dec 16 09:01:40 2016 -0500 +++ b/report_clonality/r_wrapper.sh Mon Dec 19 08:50:31 2016 -0500 @@ -106,7 +106,7 @@ echo "<link rel='stylesheet' type='text/css' href='style.css'></head>" >> $outputFile echo "<div class='tabber'><div class='tabbertab' title='Gene frequencies'>" >> $outputFile -echo "<img src='CDR3LengthPlot.png'/><br />" >> $outputFile + echo "<img src='VFPlot.png'/>" >> $outputFile if [[ "$useD" == "true" ]] ; then echo "<img src='DFPlot.png'/>" >> $outputFile @@ -116,8 +116,21 @@ echo "<img src='DPlot.png'/>" >> $outputFile fi echo "<img src='JPlot.png'/>" >> $outputFile +echo "</div>" >> $outputFile + +echo "<div class='tabbertab' title='CDR3 Characteristics'>" >> $outputFile +echo "<img src='CDR3LengthPlot.png'/><br />" >> $outputFile echo "<img src='AAComposition.png'/>" >> $outputFile echo "<img src='DReadingFrame.png'/>" >> $outputFile + +echo "<table class='pure-table pure-table-striped'>" >> $outputFile +echo "<thead><tr><th>Sample</th><th>Median CDR3 Length</th></tr></thead>" >> $outputFile +while IFS=, read Sample median +do + echo "<tr><td>$Sample</td><td>$median</td></tr>" >> $outputFile +done < $outputDir/AAMedianBySample.csv +echo "</table>" >> $outputFile + echo "</div>" >> $outputFile #Heatmaps
--- a/report_clonality_igg.xml Fri Dec 16 09:01:40 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,197 +0,0 @@ -<tool id="report_clonality_igg" name="Report Clonality" version="1.0"> - <description> </description> - <command interpreter="bash"> -#if $gene_selection.source == "imgtdb" - report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "${gene_selection.species}" "${gene_selection.locus}" $filterproductive $clonality_method -#else - report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method -#end if - </command> - <inputs> - <param name="in_file" format="tabular" type="data" label="Data to Process" /> - <param name="clonaltype" type="select" label="Clonal Type Definition (Needed for clonality calculation)"> - <option value="none">Don't remove duplicates based on clonaltype</option> - <option value="Top.V.Gene,CDR3.Seq">Top.V.Gene, CDR3 (AA)</option> - <option value="Top.V.Gene,CDR3.Seq.DNA">Top.V.Gene, CDR3 (nt)</option> - <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.J.Gene, CDR3 (AA)</option> - <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.J.Gene, CDR3 (nt)</option> - <option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (nt)</option> - <option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (AA)</option> - </param> - - <conditional name="gene_selection" > - <param name="source" type="select" label="Gene reference" help="" > - <option value="imgtdb" selected="true">IMGT-DB</option> - <option value="custom">User defined</option> - </param> - <when value="imgtdb"> - <param name="species" type="select" label="Species"> - <option value="Homo sapiens functional">Homo sapiens functional</option> - <option value="Homo sapiens">Homo sapiens</option> - <option value="Homo sapiens non-functional">Homo sapiens non-functional</option> - <option value="Bos taurus">Bos taurus</option> - <option value="Bos taurus functional">Bos taurus functional</option> - <option value="Bos taurus non-functional">Bos taurus non-functional</option> - <option value="Camelus dromedarius">Camelus dromedarius</option> - <option value="Camelus dromedarius functional">Camelus dromedarius functional</option> - <option value="Camelus dromedarius non-functional">Camelus dromedarius non-functional</option> - <option value="Canis lupus familiaris">Canis lupus familiaris</option> - <option value="Canis lupus familiaris functional">Canis lupus familiaris functional</option> - <option value="Canis lupus familiaris non-functional">Canis lupus familiaris non-functional</option> - <option value="Danio rerio">Danio rerio</option> - <option value="Danio rerio functional">Danio rerio functional</option> - <option value="Danio rerio non-functional">Danio rerio non-functional</option> - <option value="Macaca mulatta">Macaca mulatta</option> - <option value="Macaca mulatta functional">Macaca mulatta functional</option> - <option value="Macaca mulatta non-functional">Macaca mulatta non-functional</option> - <option value="Mus musculus">Mus musculus</option> - <option value="Mus musculus functional">Mus musculus functional</option> - <option value="Mus musculus non-functional">Mus musculus non-functional</option> - <option value="Mus spretus">Mus spretus</option> - <option value="Mus spretus functional">Mus spretus functional</option> - <option value="Mus spretus non-functional">Mus spretus non-functional</option> - <option value="Oncorhynchus mykiss">Oncorhynchus mykiss</option> - <option value="Oncorhynchus mykiss functional">Oncorhynchus mykiss functional</option> - <option value="Oncorhynchus mykiss non-functional">Oncorhynchus mykiss non-functional</option> - <option value="Ornithorhynchus anatinus">Ornithorhynchus anatinus</option> - <option value="Ornithorhynchus anatinus functional">Ornithorhynchus anatinus functional</option> - <option value="Ornithorhynchus anatinus non-functional">Ornithorhynchus anatinus non-functional</option> - <option value="Oryctolagus cuniculus">Oryctolagus cuniculus</option> - <option value="Oryctolagus cuniculus functional">Oryctolagus cuniculus functional</option> - <option value="Oryctolagus cuniculus non-functional">Oryctolagus cuniculus non-functional</option> - <option value="Rattus norvegicus">Rattus norvegicus</option> - <option value="Rattus norvegicus functional">Rattus norvegicus functional</option> - <option value="Rattus norvegicus non-functional">Rattus norvegicus non-functional</option> - <option value="Sus scrofa">Sus scrofa</option> - <option value="Sus scrofa functional">Sus scrofa functional</option> - <option value="Sus scrofa non-functional">Sus scrofa non-functional</option> - </param> - - <param name="locus" type="select" label="Locus"> - <option value="TRA">TRA</option> - <option value="TRD">TRD</option> - <option value="TRG">TRG</option> - <option value="TRB">TRB</option> - <option value="IGH">IGH</option> - <option value="IGI">IGI</option> - <option value="IGK">IGK</option> - <option value="IGL">IGL</option> - </param> - </when> - <when value="custom"> - <param name="species" type="hidden" value="custom" size="50" /> - <param name="vgenes" type="text" label="V Genes, add the custom genes comma seperated, no spaces" size="100" /> - <param name="dgenes" type="text" label="D Genes" size="100" /> - <param name="jgenes" type="text" label="J Genes" size="100" /> - </when> - </conditional> - - <param name="filterproductive" type="select" label="Remove the unproductive sequences from graphs "> - <option value="yes">Yes</option> - <option value="no">No</option> - </param> - - <param name="clonality_method" type="select" label="Old clonality algorithm or the newer R package"> - <option value="old">Old</option> - <option value="boyd">R Package</option> - </param> - - </inputs> - <outputs> - <data format="html" name="out_file" /> - </outputs> - <requirements> - <requirement type="package" version="3.3">weblogo</requirement> - <!--<requirement type="package" version="0.20">circostools</requirement>--> - </requirements> - <help> -**INPUT** - -One or more ARGalaxy proprietary format files combined with the ARGalaxy Experimental Design tool - - -.. class:: warningmark - -Custom gene ordering based on position on genome: - -**Human** - -IGH:: - - V: - IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1 - D: - IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27 - J: - IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6 - - -IGK:: - - V: - IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1 - J: - IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5 - - -IGL:: - - V: - IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1 - J: - IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7 - - -TRB:: - - V: - TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30 - D: - TRBD1,TRBD2 - J: - TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 - - -TRA:: - - V: - TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41 - J: - TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3 - - -TRG:: - - V: - TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2 - J: - TRGJ2,TRGJP2,TRGJ1,TRGJP1 - - -TRD:: - - V: - TRDV1,TRDV2,TRDV3 - D: - TRDD1,TRDD2,TRDD3 - J: - TRDJ1,TRDJ4,TRDJ2,TRDJ3 - - -**Mouse** - -TRB:: - - V: - TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31 - D: - TRBD1,TRBD2 - J: - TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 - - -**OUTPUT** - -It generates the following result: - </help> -</tool>