Mercurial > repos > davidvanzessen > shm_csr
diff gene_identification.py @ 92:cf8ad181628f draft
planemo upload commit 36be3b053802693392f935e6619ba3f2b1704e3c
| author | rhpvorderman |
|---|---|
| date | Mon, 12 Dec 2022 12:32:44 +0000 |
| parents | 729738462297 |
| children |
line wrap: on
line diff
--- a/gene_identification.py Wed Feb 02 10:57:36 2022 +0000 +++ b/gene_identification.py Mon Dec 12 12:32:44 2022 +0000 @@ -1,134 +1,123 @@ -import re -import argparse -import time -starttime= int(time.time() * 1000) - -parser = argparse.ArgumentParser() -parser.add_argument("--input", help="The 1_Summary file from an IMGT zip file") -parser.add_argument("--output", help="The annotated output file to be merged back with the summary file") +#!/usr/bin/env python3 -args = parser.parse_args() - -infile = args.input -#infile = "test_VH-Ca_Cg_25nt/1_Summary_test_VH-Ca_Cg_25nt_241013.txt" -output = args.output -#outfile = "identified.txt" - -dic = dict() -total = 0 +import argparse +import re +from typing import Dict, Iterator, List, Tuple -first = True -IDIndex = 0 -seqIndex = 0 +def generate_sequence_and_id_from_summary(summary_file: str + ) -> Iterator[Tuple[str, str]]: + with open(summary_file, "rt") as summary: + header = next(summary) + column_names = header.strip("\n").split("\t") + id_column = column_names.index("Sequence ID") + sequence_column = column_names.index("Sequence") + for line in summary: + values = line.strip("\n").split("\t") + id = values[id_column] + try: + sequence = values[sequence_column] + except IndexError: # weird rows without a sequence + sequence = "" + yield id, sequence -with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence - for line in f: - total += 1 - linesplt = line.split("\t") - if first: - print("linesplt", linesplt) - IDIndex = linesplt.index("Sequence ID") - seqIndex = linesplt.index("Sequence") - first = False - continue - - ID = linesplt[IDIndex] - if len(linesplt) < 28: #weird rows without a sequence - dic[ID] = "" - else: - dic[ID] = linesplt[seqIndex] - -print("Number of input sequences:", len(dic)) -#old cm sequence: gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc -#old cg sequence: ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccag - -#lambda/kappa reference sequence -searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctgg", - "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggcc", - "ce": "gcctccacacagagcccatccgtcttccccttgacccgctgctgcaaaaacattccctcc", +# old cm sequence: gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc +# old cg sequence: ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctg +# ggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcagg +# cgccctgaccag +SEARCHSTRINGS = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccag" + "atgggaacgtggtcatcgcctgcctgg", + "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctc" + "tgggggcacagcggcc", + "ce": "gcctccacacagagcccatccgtcttccccttgacccgctgctgcaaaaacatt" + "ccctcc", "cm": "gggagtgcatccgccccaacc"} #new (shorter) cm sequence -compiledregex = {"ca": [], - "cg": [], - "ce": [], - "cm": []} - -#lambda/kappa reference sequence variable nucleotides -ca1 = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'} -ca2 = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'} -cg1 = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} -cg2 = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'} -cg3 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} -cg4 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'} +#lambda/kappa referesearchstringsnce sequence variable nucleotides +CA1_MUTATIONS = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'} +CA2_MUTATIONS = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'} +CG1_MUTATIONS = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} +CG2_MUTATIONS = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'} +CG3_MUTATIONS = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} +CG4_MUTATIONS = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'} #remove last snp for shorter cg sequence --- note, also change varsInCG -del cg1[132] -del cg2[132] -del cg3[132] -del cg4[132] +del CG1_MUTATIONS[132] +del CG2_MUTATIONS[132] +del CG3_MUTATIONS[132] +del CG4_MUTATIONS[132] + +# reference sequences are cut into smaller parts of 'chunklength' length, +# and with 'chunklength' / 2 overlap +CHUNK_LENGTH = 8 -#reference sequences are cut into smaller parts of 'chunklength' length, and with 'chunklength' / 2 overlap -chunklength = 8 + +def create_compiled_regexes() -> Dict[str, List[Tuple[re.Pattern, int]]]: + + compiledregex: Dict[str, List[Tuple[re.Pattern, int]]] = { + "ca": [], + "cg": [], + "ce": [], + "cm": [] + } -#create the chunks of the reference sequence with regular expressions for the variable nucleotides -for i in range(0, len(searchstrings["ca"]) - chunklength, chunklength // 2): - pos = i - chunk = searchstrings["ca"][i:i+chunklength] - result = "" - varsInResult = 0 - for c in chunk: - if pos in list(ca1.keys()): - varsInResult += 1 - result += "[" + ca1[pos] + ca2[pos] + "]" - else: - result += c - pos += 1 - compiledregex["ca"].append((re.compile(result), varsInResult)) + for i in range(0, len(SEARCHSTRINGS["ca"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): + pos = i + chunk = SEARCHSTRINGS["ca"][i:i + CHUNK_LENGTH] + result = "" + varsInResult = 0 + for c in chunk: + if pos in list(CA1_MUTATIONS.keys()): + varsInResult += 1 + result += "[" + CA1_MUTATIONS[pos] + CA2_MUTATIONS[pos] + "]" + else: + result += c + pos += 1 + compiledregex["ca"].append((re.compile(result), varsInResult)) -for i in range(0, len(searchstrings["cg"]) - chunklength, chunklength // 2): - pos = i - chunk = searchstrings["cg"][i:i+chunklength] - result = "" - varsInResult = 0 - for c in chunk: - if pos in list(cg1.keys()): - varsInResult += 1 - result += "[" + "".join(set([cg1[pos], cg2[pos], cg3[pos], cg4[pos]])) + "]" - else: - result += c - pos += 1 - compiledregex["cg"].append((re.compile(result), varsInResult)) + for i in range(0, len(SEARCHSTRINGS["cg"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): + pos = i + chunk = SEARCHSTRINGS["cg"][i:i + CHUNK_LENGTH] + result = "" + varsInResult = 0 + for c in chunk: + if pos in list(CG1_MUTATIONS.keys()): + varsInResult += 1 + result += "[" + "".join(set([CG1_MUTATIONS[pos], CG2_MUTATIONS[pos], CG3_MUTATIONS[pos], CG4_MUTATIONS[pos]])) + "]" + else: + result += c + pos += 1 + compiledregex["cg"].append((re.compile(result), varsInResult)) -for i in range(0, len(searchstrings["cm"]) - chunklength, chunklength // 2): - compiledregex["cm"].append((re.compile(searchstrings["cm"][i:i+chunklength]), False)) + for i in range(0, len(SEARCHSTRINGS["cm"]) - CHUNK_LENGTH, CHUNK_LENGTH // 2): + compiledregex["cm"].append((re.compile(SEARCHSTRINGS["cm"][i:i + CHUNK_LENGTH]), 0)) -for i in range(0, len(searchstrings["ce"]) - chunklength + 1, chunklength // 2): - compiledregex["ce"].append((re.compile(searchstrings["ce"][i:i+chunklength]), False)) + for i in range(0, len(SEARCHSTRINGS["ce"]) - CHUNK_LENGTH + 1, CHUNK_LENGTH // 2): + compiledregex["ce"].append((re.compile(SEARCHSTRINGS["ce"][i:i + CHUNK_LENGTH]), 0)) + + return compiledregex + def removeAndReturnMaxIndex(x): #simplifies a list comprehension m = max(x) index = x.index(m) x[index] = 0 return index - + -start_location = dict() -hits = dict() -alltotal = 0 -for key in compiledregex: #for ca/cg/cm/ce - regularexpressions = compiledregex[key] # get the compiled regular expressions - for ID in list(dic.keys())[0:]: #for every ID - if ID not in list(hits.keys()): #ensure that the dictionairy that keeps track of the hits for every gene exists - hits[ID] = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ce_hits": 0, "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0} - currentIDHits = hits[ID] - seq = dic[ID] +def match_sequence(seq, compiledregex): + currentIDHits = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ce_hits": 0, + "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0} + alltotal = 0 + start_location = dict() + for key in compiledregex: # for ca/cg/cm/ce + regularexpressions = compiledregex[key] lastindex = 0 - start_zero = len(searchstrings[key]) #allows the reference sequence to start before search sequence (start_locations of < 0) + start_zero = len(SEARCHSTRINGS[key]) #allows the reference sequence to start before search sequence (start_locations of < 0) start = [0] * (len(seq) + start_zero) for i, regexp in enumerate(regularexpressions): #for every regular expression - relativeStartLocation = lastindex - (chunklength // 2) * i + relativeStartLocation = lastindex - (CHUNK_LENGTH // 2) * i if relativeStartLocation >= len(seq): break regex, hasVar = regexp @@ -137,16 +126,16 @@ lastindex += match.start() start[relativeStartLocation + start_zero] += 1 if hasVar: #if the regex has a variable nt in it - chunkstart = chunklength // 2 * i #where in the reference does this chunk start - chunkend = chunklength // 2 * i + chunklength #where in the reference does this chunk end + chunkstart = CHUNK_LENGTH // 2 * i #where in the reference does this chunk start + chunkend = CHUNK_LENGTH // 2 * i + CHUNK_LENGTH #where in the reference does this chunk end if key == "ca": #just calculate the variable nt score for 'ca', cheaper - currentIDHits["ca1"] += len([1 for x in ca1 if chunkstart <= x < chunkend and ca1[x] == seq[lastindex + x - chunkstart]]) - currentIDHits["ca2"] += len([1 for x in ca2 if chunkstart <= x < chunkend and ca2[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["ca1"] += len([1 for x in CA1_MUTATIONS if chunkstart <= x < chunkend and CA1_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["ca2"] += len([1 for x in CA2_MUTATIONS if chunkstart <= x < chunkend and CA2_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) elif key == "cg": #just calculate the variable nt score for 'cg', cheaper - currentIDHits["cg1"] += len([1 for x in cg1 if chunkstart <= x < chunkend and cg1[x] == seq[lastindex + x - chunkstart]]) - currentIDHits["cg2"] += len([1 for x in cg2 if chunkstart <= x < chunkend and cg2[x] == seq[lastindex + x - chunkstart]]) - currentIDHits["cg3"] += len([1 for x in cg3 if chunkstart <= x < chunkend and cg3[x] == seq[lastindex + x - chunkstart]]) - currentIDHits["cg4"] += len([1 for x in cg4 if chunkstart <= x < chunkend and cg4[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg1"] += len([1 for x in CG1_MUTATIONS if chunkstart <= x < chunkend and CG1_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg2"] += len([1 for x in CG2_MUTATIONS if chunkstart <= x < chunkend and CG2_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg3"] += len([1 for x in CG3_MUTATIONS if chunkstart <= x < chunkend and CG3_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg4"] += len([1 for x in CG4_MUTATIONS if chunkstart <= x < chunkend and CG4_MUTATIONS[x] == seq[lastindex + x - chunkstart]]) else: #key == "cm" #no variable regions in 'cm' or 'ce' pass break #this only breaks when there was a match with the regex, breaking means the 'else:' clause is skipped @@ -154,73 +143,87 @@ continue #print "found ", regex.pattern , "at", lastindex, "adding one to", (lastindex - chunklength / 2 * i), "to the start array of", ID, "gene", key, "it's now:", start[lastindex - chunklength / 2 * i] currentIDHits[key + "_hits"] += 1 - start_location[ID + "_" + key] = str([(removeAndReturnMaxIndex(start) + 1 - start_zero) for x in range(5) if len(start) > 0 and max(start) > 1]) - #start_location[ID + "_" + key] = str(start.index(max(start))) + start_location[key] = str([(removeAndReturnMaxIndex(start) + 1 - start_zero) for x in range(5) if len(start) > 0 and max(start) > 1]) + + cahits = currentIDHits["ca_hits"] + cghits = currentIDHits["cg_hits"] + cmhits = currentIDHits["cm_hits"] + cehits = currentIDHits["ce_hits"] + if cahits >= cghits and cahits >= cmhits and cahits >= cehits: # its a ca gene + ca1hits = currentIDHits["ca1"] + ca2hits = currentIDHits["ca2"] + if ca1hits >= ca2hits: + # TODO: All variants with 0 matched are matched to IGA1 with 0 hits + # TODO: these are later turned into unmatched by the merge_and_filter.R + # TODO: script + return "IGA1", ca1hits, cahits, start_location["ca"] + else: + return "IGA2", ca2hits, cahits, start_location["ca"] + elif cghits >= cahits and cghits >= cmhits and cghits >= cehits: # its a cg gene + cg1hits = currentIDHits["cg1"] + cg2hits = currentIDHits["cg2"] + cg3hits = currentIDHits["cg3"] + cg4hits = currentIDHits["cg4"] + if cg1hits >= cg2hits and cg1hits >= cg3hits and cg1hits >= cg4hits: # cg1 gene + return "IGG1", cg1hits, cghits, start_location["cg"] + elif cg2hits >= cg1hits and cg2hits >= cg3hits and cg2hits >= cg4hits: # cg2 gene + return "IGG2", cg2hits, cghits, start_location["cg"] + elif cg3hits >= cg1hits and cg3hits >= cg2hits and cg3hits >= cg4hits: # cg3 gene + return "IGG3", cg3hits, cghits, start_location["cg"] + else: # cg4 gene + return "IGG4", cg4hits, cghits, start_location["cg"] + else: # its a cm or ce gene + if cmhits >= cehits: + return "IGM", 0, cmhits, start_location["cm"] + else: + return "IGE", 0, cehits, start_location["ce"] -varsInCA = float(len(list(ca1.keys())) * 2) -varsInCG = float(len(list(cg1.keys())) * 2) - 2 # -2 because the sliding window doesn't hit the first and last nt twice -varsInCM = 0 -varsInCE = 0 - -def round_int(val): - return int(round(val)) - -first = True -seq_write_count=0 -with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence - with open(output, 'w') as o: - for line in f: - total += 1 - if first: - o.write("Sequence ID\tbest_match\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") - first = False - continue - linesplt = line.split("\t") - if linesplt[2] == "No results": - pass - ID = linesplt[1] - currentIDHits = hits[ID] - possibleca = float(len(compiledregex["ca"])) - possiblecg = float(len(compiledregex["cg"])) - possiblecm = float(len(compiledregex["cm"])) - possiblece = float(len(compiledregex["ce"])) - cahits = currentIDHits["ca_hits"] - cghits = currentIDHits["cg_hits"] - cmhits = currentIDHits["cm_hits"] - cehits = currentIDHits["ce_hits"] - if cahits >= cghits and cahits >= cmhits and cahits >= cehits: #its a ca gene - ca1hits = currentIDHits["ca1"] - ca2hits = currentIDHits["ca2"] - if ca1hits >= ca2hits: - o.write(ID + "\tIGA1\t" + str(round_int(ca1hits / varsInCA * 100)) + "\t" + str(round_int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n") - else: - o.write(ID + "\tIGA2\t" + str(round_int(ca2hits / varsInCA * 100)) + "\t" + str(round_int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n") - elif cghits >= cahits and cghits >= cmhits and cghits >= cehits: #its a cg gene - cg1hits = currentIDHits["cg1"] - cg2hits = currentIDHits["cg2"] - cg3hits = currentIDHits["cg3"] - cg4hits = currentIDHits["cg4"] - if cg1hits >= cg2hits and cg1hits >= cg3hits and cg1hits >= cg4hits: #cg1 gene - o.write(ID + "\tIGG1\t" + str(round_int(cg1hits / varsInCG * 100)) + "\t" + str(round_int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") - elif cg2hits >= cg1hits and cg2hits >= cg3hits and cg2hits >= cg4hits: #cg2 gene - o.write(ID + "\tIGG2\t" + str(round_int(cg2hits / varsInCG * 100)) + "\t" + str(round_int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") - elif cg3hits >= cg1hits and cg3hits >= cg2hits and cg3hits >= cg4hits: #cg3 gene - o.write(ID + "\tIGG3\t" + str(round_int(cg3hits / varsInCG * 100)) + "\t" + str(round_int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") - else: #cg4 gene - o.write(ID + "\tIGG4\t" + str(round_int(cg4hits / varsInCG * 100)) + "\t" + str(round_int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") - else: #its a cm or ce gene - if cmhits >= cehits: - o.write(ID + "\tIGM\t100\t" + str(round_int(cmhits / possiblecm * 100)) + "\t" + start_location[ID + "_cm"] + "\n") - else: - o.write(ID + "\tIGE\t100\t" + str(round_int(cehits / possiblece * 100)) + "\t" + start_location[ID + "_ce"] + "\n") - seq_write_count += 1 - -print("Time: %i" % (int(time.time() * 1000) - starttime)) - -print("Number of sequences written to file:", seq_write_count) +def main(): + parser = argparse.ArgumentParser() + parser.add_argument("--input", + help="The 1_Summary file from an IMGT zip file") + parser.add_argument("--output", + help="The annotated output file to be merged back " + "with the summary file") + args = parser.parse_args() + varsInCA = float(len(list(CA1_MUTATIONS.keys())) * 2) + varsInCG = float(len(list( + CG1_MUTATIONS.keys())) * 2) - 2 # -2 because the sliding window doesn't hit the first and last nt twice + subclass_vars = { + "IGA1": varsInCA, "IGA2": varsInCA, + "IGG1": varsInCG, "IGG2": varsInCG, "IGG3": varsInCG, "IGG4": varsInCG, + "IGE": 0, + "IGM": 0, + } + compiledregex = create_compiled_regexes() + possibleca = float(len(compiledregex["ca"])) + possiblecg = float(len(compiledregex["cg"])) + possiblecm = float(len(compiledregex["cm"])) + possiblece = float(len(compiledregex["ce"])) + class_chunks = { + "IGA1": possibleca, "IGA2": possibleca, + "IGE": possiblece, + "IGG1": possiblecg, "IGG2": possiblecg, "IGG3": possiblecg, + "IGG4": possiblecg, + "IGM": possiblecm + } + with open(args.output, "wt") as output: + output.write("Sequence ID\tbest_match\tnt_hit_percentage\t" + "chunk_hit_percentage\tstart_locations\n") + for id, sequence in generate_sequence_and_id_from_summary(args.input): + best_match, subclass_hits, class_hits, start_locations = \ + match_sequence(sequence, compiledregex) + variable_nucs = subclass_vars[best_match] + if variable_nucs: + subclass_percentage = round(subclass_hits * 100 / + variable_nucs) + else: + subclass_percentage = 100 + class_percentage = round(class_hits * 100 / class_chunks[best_match]) + output.write(f"{id}\t{best_match}\t{subclass_percentage}\t" + f"{class_percentage}\t{start_locations}\n") - - - +if __name__ == "__main__": + main()
