Mercurial > repos > dereeper > readseq
comparison readseq.xml @ 0:225031d5c818 draft
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
author | dereeper |
---|---|
date | Mon, 16 Apr 2018 08:59:28 -0400 |
parents | |
children | 36e5445b7807 |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:225031d5c818 |
---|---|
1 <tool id="sniplay_readseq" name="Readseq" version="2.0.0"> | |
2 | |
3 <!-- [REQUIRED] Tool description displayed after the tool name --> | |
4 <description> Convert various alignment formats </description> | |
5 | |
6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> | |
7 <requirements> | |
8 <requirement type="binary">perl</requirement> | |
9 <requirement type="package" version="2.1.30">readseq</requirement> | |
10 </requirements> | |
11 | |
12 <!-- [STRONGLY RECOMMANDED] Exit code rules --> | |
13 <stdio> | |
14 <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR --> | |
15 <exit_code range="1:" level="fatal" /> | |
16 </stdio> | |
17 | |
18 <!-- [REQUIRED] The command to execute --> | |
19 <command> | |
20 readseq $filein -f $format >> $fileout_log 2>&1 && | |
21 #if str( $format ) == "1": | |
22 mv ${filein}.ig $fileout | |
23 #elif str( $format ) == "2" : | |
24 mv ${filein}.gb $fileout | |
25 #elif str( $format ) == "3" : | |
26 mv ${filein}.nbrf $fileout | |
27 #elif str( $format ) == "4" : | |
28 mv ${filein}.embl $fileout | |
29 #elif str( $format ) == "5" : | |
30 mv ${filein}.gcg $fileout | |
31 #elif str( $format ) == "6" : | |
32 mv ${filein}.strider $fileout | |
33 #elif str( $format ) == "8" : | |
34 mv ${filein}.fasta $fileout | |
35 #elif str( $format ) == "11" : | |
36 mv ${filein}.phylip2 $fileout | |
37 #elif str( $format ) == "12" : | |
38 mv ${filein}.phylip $fileout | |
39 #elif str( $format ) == "13" : | |
40 mv ${filein}.seq $fileout | |
41 #elif str( $format ) == "14" : | |
42 mv ${filein}.pir $fileout | |
43 #elif str( $format ) == "15" : | |
44 mv ${filein}.msf $fileout | |
45 #elif str( $format ) == "17" : | |
46 mv ${filein}.nexus $fileout | |
47 #elif str( $format ) == "18" : | |
48 mv ${filein}.pretty $fileout | |
49 #elif str( $format ) == "19" : | |
50 mv ${filein}.xml $fileout | |
51 #elif str( $format ) == "22" : | |
52 mv ${filein}.aln $fileout | |
53 #elif str( $format ) == "25" : | |
54 mv ${filein}.ace $fileout | |
55 #end if | |
56 </command> | |
57 | |
58 <!-- [REQUIRED] Input files and tool parameters --> | |
59 <inputs> | |
60 <param name="filein" type="data" format="fasta" optional="false" label="Fasta alignment input" /> | |
61 <param name="fileout_label" type="text" value="phylip conversion" label="Output name" help="Output name for files" /> | |
62 <param name="format" type="select" label="Output format" > | |
63 <option value="1">1.IG|Stanford</option> | |
64 <option value="2">2.GenBank|gb</option> | |
65 <option value="3">3.NBRF</option> | |
66 <option value="4">4.EMBL|em</option> | |
67 <option value="5">5.GCG</option> | |
68 <option value="6">6.DNAStrider</option> | |
69 <option value="8">8.Pearson|Fasta|fa</option> | |
70 <option value="11">11.Phylip3.2</option> | |
71 <option value="12" selected="true">12.Phylip|Phylip4</option> | |
72 <option value="13">13.Plain|Raw</option> | |
73 <option value="14">14.PIR|CODATA</option> | |
74 <option value="15">15.MSF</option> | |
75 <option value="17">17.PAUP|NEXUS</option> | |
76 <option value="18">18.Pretty</option> | |
77 <option value="19">19.XML</option> | |
78 <option value="22">22.Clustal</option> | |
79 <option value="25">25.ACEDB</option> | |
80 </param> | |
81 </inputs> | |
82 | |
83 <!-- [REQUIRED] Output files --> | |
84 <outputs> | |
85 <data name="fileout_log" format="txt" label="${fileout_label}.log" /> | |
86 <data name="fileout" format="txt" label="${fileout_label}" > | |
87 <change_format> | |
88 <when input="format" value="1" format="ig" /> | |
89 <when input="format" value="2" format="genbank" /> | |
90 <when input="format" value="4" format="embl" /> | |
91 <when input="format" value="5" format="gcg" /> | |
92 <when input="format" value="6" format="strider" /> | |
93 <when input="format" value="8" format="fasta" /> | |
94 <when input="format" value="11" format="phylip" /> | |
95 <when input="format" value="12" format="phylip" /> | |
96 <when input="format" value="14" format="pir" /> | |
97 <when input="format" value="17" format="nexus" /> | |
98 <when input="format" value="18" format="prettyseq" /> | |
99 <when input="format" value="19" format="xml" /> | |
100 <when input="format" value="22" format="clustal" /> | |
101 <when input="format" value="25" format="acedb" /> | |
102 </change_format> | |
103 </data> | |
104 </outputs> | |
105 | |
106 <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> | |
107 <tests> | |
108 <!-- [HELP] Test files have to be in the ~/test-data directory --> | |
109 <test> | |
110 <param name="filein" value="readseq-alignment.fa" /> | |
111 <param name="format" value="1" /> | |
112 <output name="fileout" file="readseq-standford" /> | |
113 </test> | |
114 <test> | |
115 <param name="filein" value="readseq-alignment.fa" /> | |
116 <param name="format" value="2" /> | |
117 <output name="fileout" file="readseq-GenBank" /> | |
118 </test> | |
119 <test> | |
120 <param name="filein" value="readseq-alignment.fa" /> | |
121 <param name="format" value="3" /> | |
122 <output name="fileout" file="readseq-NBRF" /> | |
123 </test> | |
124 <test> | |
125 <param name="filein" value="readseq-alignment.fa" /> | |
126 <param name="format" value="4" /> | |
127 <output name="fileout" file="readseq-EMBL" /> | |
128 </test> | |
129 <test> | |
130 <param name="filein" value="readseq-alignment.fa" /> | |
131 <param name="format" value="5" /> | |
132 <assert_command> | |
133 <has_text text="-f 5" /> | |
134 <has_text text=".gcg" /> | |
135 </assert_command> | |
136 </test> | |
137 <test> | |
138 <param name="filein" value="readseq-alignment.fa" /> | |
139 <param name="format" value="6" /> | |
140 <output name="fileout" file="readseq-DNAStrider" /> | |
141 </test> | |
142 <test> | |
143 <param name="filein" value="readseq-alignment.fa" /> | |
144 <param name="format" value="8" /> | |
145 <output name="fileout" file="readseq-Pearson" /> | |
146 </test> | |
147 <test> | |
148 <param name="filein" value="readseq-alignment.fa" /> | |
149 <param name="format" value="11" /> | |
150 <output name="fileout" file="readseq-phylip32" /> | |
151 </test> | |
152 <test> | |
153 <param name="filein" value="readseq-alignment.fa" /> | |
154 <param name="format" value="12" /> | |
155 <output name="fileout" file="readseq-phylip" /> | |
156 </test> | |
157 <test> | |
158 <param name="filein" value="readseq-alignment.fa" /> | |
159 <param name="format" value="13" /> | |
160 <output name="fileout" file="readseq-raw" /> | |
161 </test> | |
162 <test> | |
163 <param name="filein" value="readseq-alignment.fa" /> | |
164 <param name="format" value="14" /> | |
165 <output name="fileout" file="readseq-PIR" /> | |
166 </test> | |
167 <test> | |
168 <param name="filein" value="readseq-alignment.fa" /> | |
169 <param name="format" value="15" /> | |
170 <output name="fileout" file="readseq-MSF.txt" lines_diff="2" /> | |
171 </test> | |
172 <test> | |
173 <param name="filein" value="readseq-alignment.fa" /> | |
174 <param name="format" value="17" /> | |
175 <output name="fileout" file="readseq-NEXUS" /> | |
176 </test> | |
177 <test> | |
178 <param name="filein" value="readseq-alignment.fa" /> | |
179 <param name="format" value="18" /> | |
180 <output name="fileout" file="readseq-Pretty" /> | |
181 </test> | |
182 <test> | |
183 <param name="filein" value="readseq-alignment.fa" /> | |
184 <param name="format" value="19" /> | |
185 <output name="fileout" file="readseq-XML" /> | |
186 </test> | |
187 <test> | |
188 <param name="filein" value="readseq-alignment.fa" /> | |
189 <param name="format" value="22" /> | |
190 <output name="fileout" file="readseq-Clustal" /> | |
191 </test> | |
192 <test> | |
193 <param name="filein" value="readseq-alignment.fa" /> | |
194 <param name="format" value="25" /> | |
195 <output name="fileout" file="readseq-ACEDB" /> | |
196 </test> | |
197 | |
198 </tests> | |
199 | |
200 <!-- [OPTIONAL] Help displayed in Galaxy --> | |
201 <help><![CDATA[ | |
202 | |
203 .. class:: infomark | |
204 | |
205 **Authors** Don Gilbert software@bio.indiana.edu | |
206 | |
207 | **Please cite** If you use this tool, please cite Don Gilbert software@bio.indiana.edu | |
208 | |
209 .. class:: infomark | |
210 | |
211 **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA) | |
212 | |
213 .. class:: infomark | |
214 | |
215 **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr | |
216 | |
217 --------------------------------------------------- | |
218 | |
219 ======= | |
220 Readseq | |
221 ======= | |
222 | |
223 ----------- | |
224 Description | |
225 ----------- | |
226 | |
227 | Compute a phylip tree from a fasta alignment. | |
228 | |
229 ------------ | |
230 Dependencies | |
231 ------------ | |
232 ReadSeq | |
233 readseq_ 2.1.30, Conda version | |
234 | |
235 .. _readseq: https://anaconda.org/bioconda/readseq | |
236 | |
237 ---------- | |
238 Input file | |
239 ---------- | |
240 | |
241 Fasta file | |
242 The input data file contains sequence alignment(s) | |
243 | |
244 | |
245 --------- | |
246 Parameter | |
247 --------- | |
248 | |
249 Output name | |
250 Output base name for the ouput files | |
251 | |
252 | |
253 ------------ | |
254 Output files | |
255 ------------ | |
256 | |
257 Output_name | |
258 Resulting tree in phylip format | |
259 | |
260 Output_name.log | |
261 Log file | |
262 | |
263 --------------------------------------------------- | |
264 | |
265 --------------- | |
266 Working example | |
267 --------------- | |
268 | |
269 Input file | |
270 ========== | |
271 | |
272 Fasta file | |
273 ----------- | |
274 | |
275 :: | |
276 | |
277 >IRAT112 GAGAACCGTCCTGTAAGTACTCTTGCTTTAAGTAATAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATTATCATTATGAATCAATAAACAACTTGATGTTGTGCTCCATGTACGATATATAAAGACAGATA | |
278 >KARASUKARASURANKASU GAGAACCGTCCTGTAAGTACTCTTGCTTTAAATACGAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATGTTCATCATGAATCTATAGTTAACTTGATGTTGTGCTCCATGTACGATATAAAAAGTTAGATA | |
279 | |
280 | |
281 Parameters | |
282 ========== | |
283 | |
284 Output name -> phylip conversion | |
285 | |
286 | |
287 Output file | |
288 =========== | |
289 | |
290 phylip conversion | |
291 ----------------- | |
292 | |
293 :: | |
294 | |
295 168 5125 | |
296 IRAT112 GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AGTAATAAAG TAATACTAAT | |
297 KARASUKARA GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AATACGAAAG TAATACTAAT | |
298 | |
299 ]]></help> | |
300 <citations> | |
301 <citation type="doi" >10.1002/0471250953.bia01es00</citation> | |
302 </citations> | |
303 | |
304 </tool> |