Mercurial > repos > dereeper > sniplay
comparison VCF2Hapmap/vcf2FastaAndHapmap.xml @ 3:345f88a8f483 draft
Uploaded
author | dereeper |
---|---|
date | Fri, 10 Jul 2015 10:38:43 -0400 |
parents | 420b57c3c185 |
children | 10627af23f10 |
comparison
equal
deleted
inserted
replaced
2:feb40a9a8eae | 3:345f88a8f483 |
---|---|
1 <tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="1.1.0"> | |
2 | |
3 <!-- [REQUIRED] Tool description displayed after the tool name --> | |
4 <description> Convert VCF to Hapmap </description> | |
5 | |
6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> | |
7 <requirements> | |
8 <requirement type="binary">perl</requirement> | |
9 </requirements> | |
10 | |
11 <!-- [OPTIONAL] Command to be executed to get the tool's version string --> | |
12 <version_command> | |
13 <!-- | |
14 tool_binary -v | |
15 --> | |
16 </version_command> | |
17 | |
18 <!-- [REQUIRED] The command to execute --> | |
19 <command interpreter="bash"> | |
20 vcf2FastaAndHapmap.sh $filein $fileout_label $fileout $optional.file_opt | |
21 #if str( $optional.file_opt ) != "none": | |
22 $fileout_seq $fileout_fa1 $filefasta | |
23 #if str( $optional.file_opt ) == "fasta_gff": | |
24 $filegff | |
25 #end if | |
26 #end if | |
27 </command> | |
28 | |
29 <!-- [REQUIRED] Input files and tool parameters --> | |
30 <inputs> | |
31 <param name="filein" type="data" format="vcf" optional="false" label="VCF input" /> | |
32 <param name="fileout_label" type="text" value="input" optional="false" label="Output file basename"/> | |
33 <conditional name="optional" > | |
34 <param name="file_opt" type="select" label="Optional files" > | |
35 <option value="none" selected="true">No</option> | |
36 <option value="fasta">Fasta</option> | |
37 <option value="fasta_gff">Fasta and GFF</option> | |
38 </param> | |
39 <when value="none" /> | |
40 <when value="fasta"> | |
41 <param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" /> | |
42 </when> | |
43 <when value="fasta_gff"> | |
44 <param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" /> | |
45 <param name="filegff" type="data" format="gff" optional="false" label="GFF file input" help="VCF file must be annotated" /> | |
46 </when> | |
47 </conditional> | |
48 </inputs> | |
49 | |
50 <!-- [REQUIRED] Output files --> | |
51 <outputs> | |
52 <data name="fileout" format="txt" label="${fileout_label}.hapmap" /> | |
53 <data name="fileout_seq" format="txt" label="${fileout_label}.flanking.txt"> | |
54 <filter>(optional['file_opt'] != 'none')</filter> | |
55 </data> | |
56 <data name="fileout_fa1" format="fasta" label="${fileout_label}.gene_alignment.fas"> | |
57 <filter>(optional['file_opt'] == 'fasta_gff')</filter> | |
58 </data> | |
59 </outputs> | |
60 | |
61 <!-- [STRONGLY RECOMMANDED] Exit code rules --> | |
62 <stdio> | |
63 <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR --> | |
64 <exit_code range="1:" level="fatal" /> | |
65 </stdio> | |
66 | |
67 <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> | |
68 <tests> | |
69 <!-- [HELP] Test files have to be in the ~/test-data directory --> | |
70 <test> | |
71 <param name="filein" value="sample.vcf" /> | |
72 <param name="otpional.file_opt" value="none" /> | |
73 <output name="fileout" file="result1.hapmap" /> | |
74 </test> | |
75 <test> | |
76 <param name="filein" value="sample.vcf" /> | |
77 <param name="otpional.file_opt" value="fasta" /> | |
78 <param name="filefasta" value="reference.fa" /> | |
79 <output name="fileout" file="result2.hapmap" /> | |
80 <output name="fileout_seq" file="result2.flanking.txt" /> | |
81 <output name="fileout_fa1" file="result2.gene_alignment.fas" /> | |
82 </test> | |
83 </tests> | |
84 | |
85 <!-- [OPTIONAL] Help displayed in Galaxy --> | |
86 <help> | |
87 | |
88 | |
89 .. class:: infomark | |
90 | |
91 **Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform | |
92 | |
93 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). | |
94 | |
95 .. class:: infomark | |
96 | |
97 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. | |
98 | |
99 .. class:: infomark | |
100 | |
101 **Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr | |
102 | |
103 --------------------------------------------------- | |
104 | |
105 ======================= | |
106 VCF to Hapmap | |
107 ======================= | |
108 | |
109 ----------- | |
110 Description | |
111 ----------- | |
112 | |
113 | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided. | |
114 | Furthermore it also creates fasta alignment of genes if GFF annotation is provided | |
115 | |
116 ----------------- | |
117 Workflow position | |
118 ----------------- | |
119 | |
120 **Upstream tool** | |
121 | |
122 =============== ========================== ======= | |
123 Name output file(s) format | |
124 =============== ========================== ======= | |
125 VCFtools Filter VCF file VCF | |
126 =============== ========================== ======= | |
127 | |
128 | |
129 **Downstream tool** | |
130 | |
131 =============== ========================== =========== | |
132 Name input file(s) format | |
133 =============== ========================== =========== | |
134 SNP density Hapmap file tabular | |
135 =============== ========================== =========== | |
136 | |
137 | |
138 ---------- | |
139 Input file | |
140 ---------- | |
141 | |
142 VCF file | |
143 VCF file with all SNPs | |
144 | |
145 ---------- | |
146 Parameters | |
147 ---------- | |
148 | |
149 Output file basename | |
150 Prefix for the output VCF file | |
151 | |
152 Optional files | |
153 To add additional files fasta file and GFF file. | |
154 | |
155 ------------ | |
156 Output files | |
157 ------------ | |
158 | |
159 Hapmap file | |
160 Hapmap converted file | |
161 | |
162 Additional files | |
163 If you add fasta and/or GFF file as reference, you obtain 3 more files : One with flanking sequence and a fasta file | |
164 | |
165 --------------------------------------------------- | |
166 | |
167 --------------- | |
168 Working example | |
169 --------------- | |
170 | |
171 Input files | |
172 =========== | |
173 | |
174 VCF file | |
175 --------- | |
176 | |
177 :: | |
178 | |
179 #fileformat=VCFv4.1 | |
180 #FILTER=<ID=LowQual,Description="Low quality"> | |
181 #FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed"> | |
182 [...] | |
183 CHROM POS ID REF ALT QUAL FILTER INFO FORMAT CATB1 | |
184 chr1 2209 . G T 213.84 . AC=2;AF=1.00;AN=2;DP=7;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=41.50;MQ0=0;QD=30.55;EFF=DOWNSTREAM(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|) GT:AD:DP:GQ:PL 1/1:0,7:7:18:242,18,0 | |
185 | |
186 Fasta file | |
187 ---------- | |
188 | |
189 | |
190 :: | |
191 | |
192 >chr1 | |
193 CAGTAAAGTTTGCAAAGAGATTCTGGCAAAGTT | |
194 | |
195 Parameters | |
196 ========== | |
197 | |
198 Output name -> input | |
199 | |
200 Optional files -> Fasta | |
201 | |
202 | |
203 Output files | |
204 ============ | |
205 | |
206 input.hapmap | |
207 ------------ | |
208 | |
209 :: | |
210 | |
211 rs# alleles chrom pos strand assembly# center protLSID assayLSID panelLSID QCcode CATB1 | |
212 chr1:2209 G/T chr1 2209 + NA NA NA NA NA NA GG TT | |
213 chr1:2232 A/C chr1 2232 + NA NA NA NA NA NA AA CC | |
214 | |
215 input.flanking.txt | |
216 ------------------ | |
217 | |
218 :: | |
219 | |
220 chr1-2209,GTCGCATCTGCAGCATATAGCCAACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCT[G/T]ACTGGCTTAACGATATTGTAAGMTGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCT,0,0,0,Project_name,0,diploid,Other,Forward | |
221 chr1-2232,ACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCTKACTGGCTTAACGATATTGTAAG[A/C]TGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCTGTCCCCAGCCGTGCTGACTGGGC,0,0,0,Project_name,0,diploid,Other,Forward | |
222 | |
223 input.gene_alignment.fas | |
224 ------------------------ | |
225 | |
226 :: | |
227 | |
228 >chr1_CATB1_1 | |
229 TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT | |
230 | |
231 | |
232 </help> | |
233 | |
234 <citations> | |
235 <!-- [HELP] As DOI or BibTex entry --> | |
236 <citation type="bibtex">@article{Dereeper03062015, | |
237 author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel}, | |
238 title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations}, | |
239 year = {2015}, | |
240 doi = {10.1093/nar/gkv351}, | |
241 abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.}, | |
242 URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract}, | |
243 eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html}, | |
244 journal = {Nucleic Acids Research} | |
245 } | |
246 | |
247 }</citation> | |
248 | |
249 </citations> | |
250 | |
251 </tool> |